Daily Archives: 2025年11月13日

Processing Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606 v3

  1. Vorgabe

     #perform PCA analysis, Venn diagram analysis, as well as KEGG and GO annotations. We would also appreciate it if you could include CPM calculations for this dataset (gene_cpm_counts.xlsx). For comparative analysis, we are particularly interested in identifying DEGs between WT and ΔIJ across the different treatments and time points.
    
     I have already performed the six comparisons, using WT as the reference:
    
         ΔIJ-17 vs WT-17 – no treatment
         ΔIJ-24 vs WT-24 – no treatment
         preΔIJ-17 vs preWT-17 – Treatment A
         preΔIJ-24 vs preWT-24 – Treatment A
         0_5ΔIJ-17 vs 0_5WT-17 – Treatment B
         0_5ΔIJ-24 vs 0_5WT-24 – Treatment B
    
     To gain a deeper understanding of how the ∆adeIJ mutation influences response dynamics over time and under different stimuli, would you also be interested in the following additional comparisons?
    
     Within-strain treatment responses
     (to explore how each strain responds to treatments):
    
     WT:
    
         preWT-17 vs WT-17 → response to Treatment A at 17 h
         preWT-24 vs WT-24 → response to Treatment A at 24 h
         0_5WT-17 vs WT-17 → response to Treatment B at 17 h
         0_5WT-24 vs WT-24 → response to Treatment B at 24 h
    
     ∆adeIJ:
    
         preΔIJ-17 vs ΔIJ-17 → response to Treatment A at 17 h
         preΔIJ-24 vs ΔIJ-24 → response to Treatment A at 24 h
         0_5ΔIJ-17 vs ΔIJ-17 → response to Treatment B at 17 h
         0_5ΔIJ-24 vs ΔIJ-24 → response to Treatment B at 24 h
    
     Time-course comparisons
     (to investigate time-dependent changes within each condition):
    
         WT-24 vs WT-17
         ΔIJ-24 vs ΔIJ-17
         preWT-24 vs preWT-17
         preΔIJ-24 vs preΔIJ-17
         0_5WT-24 vs 0_5WT-17
         0_5ΔIJ-24 vs 0_5ΔIJ-17
    
     I reviewed the datasets again and noticed that there are no ∆adeAB samples included. Should we try to obtain ∆adeAB data from other datasets? However, I’m a bit concerned that batch effects might pose a challenge when integrating data from different datasets.
    
     > It is possible to analyze DEGs across various time points (17 and 24 h) and stimuli (treatment A and B, and without treatment) iswithin both the ∆adeIJ mutant and the WT strain as our phenotypic characterization of these strains across two times points and stimuli shows significant differences but the other mutant ∆adeAB (similar function as AdeIJ) shows no difference compared to WT, therefore we are wondering what's happened to ∆adeIJ.
    
     deltaIJ_17, WT_17 – ΔadeIJ and wildtype strains w/o exposure at 17 h (No treatment)
     deltaIJ_24, WT_24 – ΔadeIJ and wildtype strains w/o exposure at 24 h (No treatment)
     pre_deltaIJ_17, pre_WT_17 – ΔadeIJ and wildtype strains with 1 exposure at 17 h (Treatment A)
     pre_deltaIJ_24, pre_WT_24 – ΔadeIJ and wildtype strains with 1 exposure at 24 h (Treatment A)
     0_5_deltaIJ_17, 0_5_WT_17 – ΔadeIJ and wildtype strains with 2 exposure at 17 h (Treatment B)
     0_5_deltaIJ_24, 0_5_WT_24 – ΔadeIJ and wildtype strains with 2 exposure at 24 h (Treatment B)
  2. Preparing raw data

     mkdir raw_data; cd raw_data
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-1/WT-17-1_1.fq.gz WT-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-1/WT-17-1_2.fq.gz WT-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-2/WT-17-2_1.fq.gz WT-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-2/WT-17-2_2.fq.gz WT-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-3/WT-17-3_1.fq.gz WT-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-17-3/WT-17-3_2.fq.gz WT-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-1/WT-24-1_1.fq.gz WT-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-1/WT-24-1_2.fq.gz WT-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-2/WT-24-2_1.fq.gz WT-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-2/WT-24-2_2.fq.gz WT-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-3/WT-24-3_1.fq.gz WT-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT-24-3/WT-24-3_2.fq.gz WT-24-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-1/ΔIJ-17-1_1.fq.gz deltaIJ-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-1/ΔIJ-17-1_2.fq.gz deltaIJ-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-2/ΔIJ-17-2_1.fq.gz deltaIJ-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-2/ΔIJ-17-2_2.fq.gz deltaIJ-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-3/ΔIJ-17-3_1.fq.gz deltaIJ-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-17-3/ΔIJ-17-3_2.fq.gz deltaIJ-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-1/ΔIJ-24-1_1.fq.gz deltaIJ-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-1/ΔIJ-24-1_2.fq.gz deltaIJ-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-2/ΔIJ-24-2_1.fq.gz deltaIJ-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-2/ΔIJ-24-2_2.fq.gz deltaIJ-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-3/ΔIJ-24-3_1.fq.gz deltaIJ-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/ΔIJ-24-3/ΔIJ-24-3_2.fq.gz deltaIJ-24-r3_R2.fq.gz
    
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-1/preWT-17-1_1.fq.gz pre_WT-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-1/preWT-17-1_2.fq.gz pre_WT-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-2/preWT-17-2_1.fq.gz pre_WT-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-2/preWT-17-2_2.fq.gz pre_WT-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-3/preWT-17-3_1.fq.gz pre_WT-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-17-3/preWT-17-3_2.fq.gz pre_WT-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-1/preWT-24-1_1.fq.gz pre_WT-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-1/preWT-24-1_2.fq.gz pre_WT-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-2/preWT-24-2_1.fq.gz pre_WT-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-2/preWT-24-2_2.fq.gz pre_WT-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-3/preWT-24-3_1.fq.gz pre_WT-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preWT-24-3/preWT-24-3_2.fq.gz pre_WT-24-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-1/preΔIJ-17-1_1.fq.gz pre_deltaIJ-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-1/preΔIJ-17-1_2.fq.gz pre_deltaIJ-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-2/preΔIJ-17-2_1.fq.gz pre_deltaIJ-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-2/preΔIJ-17-2_2.fq.gz pre_deltaIJ-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-3/preΔIJ-17-3_1.fq.gz pre_deltaIJ-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-17-3/preΔIJ-17-3_2.fq.gz pre_deltaIJ-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-1/preΔIJ-24-1_1.fq.gz pre_deltaIJ-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-1/preΔIJ-24-1_2.fq.gz pre_deltaIJ-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-2/preΔIJ-24-2_1.fq.gz pre_deltaIJ-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-2/preΔIJ-24-2_2.fq.gz pre_deltaIJ-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-3/preΔIJ-24-3_1.fq.gz pre_deltaIJ-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/preΔIJ-24-3/preΔIJ-24-3_2.fq.gz pre_deltaIJ-24-r3_R2.fq.gz
    
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-1/WT0_5-17-1_1.fq.gz 0_5_WT-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-1/WT0_5-17-1_2.fq.gz 0_5_WT-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-2/WT0_5-17-2_1.fq.gz 0_5_WT-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-2/WT0_5-17-2_2.fq.gz 0_5_WT-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-3/WT0_5-17-3_1.fq.gz 0_5_WT-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-17-3/WT0_5-17-3_2.fq.gz 0_5_WT-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-1/WT0_5-24-1_1.fq.gz 0_5_WT-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-1/WT0_5-24-1_2.fq.gz 0_5_WT-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-2/WT0_5-24-2_1.fq.gz 0_5_WT-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-2/WT0_5-24-2_2.fq.gz 0_5_WT-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-3/WT0_5-24-3_1.fq.gz 0_5_WT-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/WT0_5-24-3/WT0_5-24-3_2.fq.gz 0_5_WT-24-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-1/0_5ΔIJ-17-1_1.fq.gz 0_5_deltaIJ-17-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-1/0_5ΔIJ-17-1_2.fq.gz 0_5_deltaIJ-17-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-2/0_5ΔIJ-17-2_1.fq.gz 0_5_deltaIJ-17-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-2/0_5ΔIJ-17-2_2.fq.gz 0_5_deltaIJ-17-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-3/0_5ΔIJ-17-3_1.fq.gz 0_5_deltaIJ-17-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-17-3/0_5ΔIJ-17-3_2.fq.gz 0_5_deltaIJ-17-r3_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-1/0_5ΔIJ-24-1_1.fq.gz 0_5_deltaIJ-24-r1_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-1/0_5ΔIJ-24-1_2.fq.gz 0_5_deltaIJ-24-r1_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-2/0_5ΔIJ-24-2_1.fq.gz 0_5_deltaIJ-24-r2_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-2/0_5ΔIJ-24-2_2.fq.gz 0_5_deltaIJ-24-r2_R2.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-3/0_5ΔIJ-24-3_1.fq.gz 0_5_deltaIJ-24-r3_R1.fq.gz
     ln -s ../RSMR00204/X101SC25062155-Z01/X101SC25062155-Z01-J001/01.RawData/0_5ΔIJ-24-3/0_5ΔIJ-24-3_2.fq.gz 0_5_deltaIJ-24-r3_R2.fq.gz
  3. (Done) Downloading CP059040.fasta and CP059040.gff from GenBank

  4. Preparing the directory trimmed

     mkdir trimmed trimmed_unpaired;
     for sample_id in WT-17-r1 WT-17-r2 WT-17-r3 WT-24-r1 WT-24-r2 WT-24-r3 deltaIJ-17-r1 deltaIJ-17-r2 deltaIJ-17-r3 deltaIJ-24-r1 deltaIJ-24-r2 deltaIJ-24-r3  pre_WT-17-r1 pre_WT-17-r2 pre_WT-17-r3 pre_WT-24-r1 pre_WT-24-r2 pre_WT-24-r3 pre_deltaIJ-17-r1 pre_deltaIJ-17-r2 pre_deltaIJ-17-r3 pre_deltaIJ-24-r1 pre_deltaIJ-24-r2 pre_deltaIJ-24-r3  0_5_WT-17-r1 0_5_WT-17-r2 0_5_WT-17-r3 0_5_WT-24-r1 0_5_WT-24-r2 0_5_WT-24-r3 0_5_deltaIJ-17-r1 0_5_deltaIJ-17-r2 0_5_deltaIJ-17-r3 0_5_deltaIJ-24-r1 0_5_deltaIJ-24-r2 0_5_deltaIJ-24-r3; do \
             java -jar /home/jhuang/Tools/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 100 raw_data/${sample_id}_R1.fq.gz raw_data/${sample_id}_R2.fq.gz trimmed/${sample_id}_R1.fq.gz trimmed_unpaired/${sample_id}_R1.fq.gz trimmed/${sample_id}_R2.fq.gz trimmed_unpaired/${sample_id}_R2.fq.gz ILLUMINACLIP:/home/jhuang/Tools/Trimmomatic-0.36/adapters/TruSeq3-PE-2.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:20; done 2> trimmomatic_pe.log;
     done
  5. Preparing samplesheet.csv

     sample,fastq_1,fastq_2,strandedness
     WT_17_r1,WT-17-r1_R1.fq.gz,WT-17-r1_R2.fq.gz,auto
     WT_17_r2,WT-17-r2_R1.fq.gz,WT-17-r2_R2.fq.gz,auto
     WT_17_r3,WT-17-r3_R1.fq.gz,WT-17-r3_R2.fq.gz,auto
     WT_24_r1,WT-24-r1_R1.fq.gz,WT-24-r1_R2.fq.gz,auto
     WT_24_r2,WT-24-r2_R1.fq.gz,WT-24-r2_R2.fq.gz,auto
     WT_24_r3,WT-24-r3_R1.fq.gz,WT-24-r3_R2.fq.gz,auto
     deltaIJ_17_r1,deltaIJ-17-r1_R1.fq.gz,deltaIJ-17-r1_R2.fq.gz,auto
     deltaIJ_17_r2,deltaIJ-17-r2_R1.fq.gz,deltaIJ-17-r2_R2.fq.gz,auto
     deltaIJ_17_r3,deltaIJ-17-r3_R1.fq.gz,deltaIJ-17-r3_R2.fq.gz,auto
     deltaIJ_24_r1,deltaIJ-24-r1_R1.fq.gz,deltaIJ-24-r1_R2.fq.gz,auto
     deltaIJ_24_r2,deltaIJ-24-r2_R1.fq.gz,deltaIJ-24-r2_R2.fq.gz,auto
     deltaIJ_24_r3,deltaIJ-24-r3_R1.fq.gz,deltaIJ-24-r3_R2.fq.gz,auto
     pre_WT_17_r1,pre_WT-17-r1_R1.fq.gz,pre_WT-17-r1_R2.fq.gz,auto
     pre_WT_17_r2,pre_WT-17-r2_R1.fq.gz,pre_WT-17-r2_R2.fq.gz,auto
     pre_WT_17_r3,pre_WT-17-r3_R1.fq.gz,pre_WT-17-r3_R2.fq.gz,auto
     pre_WT_24_r1,pre_WT-24-r1_R1.fq.gz,pre_WT-24-r1_R2.fq.gz,auto
     pre_WT_24_r2,pre_WT-24-r2_R1.fq.gz,pre_WT-24-r2_R2.fq.gz,auto
     pre_WT_24_r3,pre_WT-24-r3_R1.fq.gz,pre_WT-24-r3_R2.fq.gz,auto
     pre_deltaIJ_17_r1,pre_deltaIJ-17-r1_R1.fq.gz,pre_deltaIJ-17-r1_R2.fq.gz,auto
     pre_deltaIJ_17_r2,pre_deltaIJ-17-r2_R1.fq.gz,pre_deltaIJ-17-r2_R2.fq.gz,auto
     pre_deltaIJ_17_r3,pre_deltaIJ-17-r3_R1.fq.gz,pre_deltaIJ-17-r3_R2.fq.gz,auto
     pre_deltaIJ_24_r1,pre_deltaIJ-24-r1_R1.fq.gz,pre_deltaIJ-24-r1_R2.fq.gz,auto
     pre_deltaIJ_24_r2,pre_deltaIJ-24-r2_R1.fq.gz,pre_deltaIJ-24-r2_R2.fq.gz,auto
     pre_deltaIJ_24_r3,pre_deltaIJ-24-r3_R1.fq.gz,pre_deltaIJ-24-r3_R2.fq.gz,auto
     0_5_WT_17_r1,0_5_WT-17-r1_R1.fq.gz,0_5_WT-17-r1_R2.fq.gz,auto
     0_5_WT_17_r2,0_5_WT-17-r2_R1.fq.gz,0_5_WT-17-r2_R2.fq.gz,auto
     0_5_WT_17_r3,0_5_WT-17-r3_R1.fq.gz,0_5_WT-17-r3_R2.fq.gz,auto
     0_5_WT_24_r1,0_5_WT-24-r1_R1.fq.gz,0_5_WT-24-r1_R2.fq.gz,auto
     0_5_WT_24_r2,0_5_WT-24-r2_R1.fq.gz,0_5_WT-24-r2_R2.fq.gz,auto
     0_5_WT_24_r3,0_5_WT-24-r3_R1.fq.gz,0_5_WT-24-r3_R2.fq.gz,auto
     0_5_deltaIJ_17_r1,0_5_deltaIJ-17-r1_R1.fq.gz,0_5_deltaIJ-17-r1_R2.fq.gz,auto
     0_5_deltaIJ_17_r2,0_5_deltaIJ-17-r2_R1.fq.gz,0_5_deltaIJ-17-r2_R2.fq.gz,auto
     0_5_deltaIJ_17_r3,0_5_deltaIJ-17-r3_R1.fq.gz,0_5_deltaIJ-17-r3_R2.fq.gz,auto
     0_5_deltaIJ_24_r1,0_5_deltaIJ-24-r1_R1.fq.gz,0_5_deltaIJ-24-r1_R2.fq.gz,auto
     0_5_deltaIJ_24_r2,0_5_deltaIJ-24-r2_R1.fq.gz,0_5_deltaIJ-24-r2_R2.fq.gz,auto
     0_5_deltaIJ_24_r3,0_5_deltaIJ-24-r3_R1.fq.gz,0_5_deltaIJ-24-r3_R2.fq.gz,auto
  6. nextflow run

     #Example1: http://xgenes.com/article/article-content/157/prepare-virus-gtf-for-nextflow-run/
    
     docker pull nfcore/rnaseq
     ln -s /home/jhuang/Tools/nf-core-rnaseq-3.12.0/ rnaseq
    
     #Default: --gtf_group_features 'gene_id'  --gtf_extra_attributes 'gene_name' --featurecounts_group_type 'gene_biotype' --featurecounts_feature_type 'exon'
     #(host_env) !NOT_WORKING! jhuang@WS-2290C:~/DATA/Data_Tam_RNAseq_2024$ /usr/local/bin/nextflow run rnaseq/main.nf --input samplesheet.csv --outdir results    --fasta "/home/jhuang/DATA/Data_Tam_RNAseq_2024/CP059040.fasta" --gff "/home/jhuang/DATA/Data_Tam_RNAseq_2024/CP059040.gff"        -profile docker -resume  --max_cpus 55 --max_memory 512.GB --max_time 2400.h    --save_align_intermeds --save_unaligned --save_reference    --aligner 'star_salmon'    --gtf_group_features 'gene_id'  --gtf_extra_attributes 'gene_name' --featurecounts_group_type 'gene_biotype' --featurecounts_feature_type 'transcript'
    
     # -- DEBUG_1 (CDS --> exon in CP059040.gff) --
     #Checking the record (see below) in results/genome/CP059040.gtf
     #In ./results/genome/CP059040.gtf e.g. "CP059040.1      Genbank transcript      1       1398    .       +       .       transcript_id "gene-H0N29_00005"; gene_id "gene-H0N29_00005"; gene_name "dnaA"; Name "dnaA"; gbkey "Gene"; gene "dnaA"; gene_biotype "protein_coding"; locus_tag "H0N29_00005";"
     #--featurecounts_feature_type 'transcript' returns only the tRNA results
     #Since the tRNA records have "transcript and exon". In gene records, we have "transcript and CDS". replace the CDS with exon
    
     grep -P "\texon\t" CP059040.gff | sort | wc -l    #96
     grep -P "cmsearch\texon\t" CP059040.gff | wc -l    #=10  ignal recognition particle sRNA small typ, transfer-messenger RNA, 5S ribosomal RNA
     grep -P "Genbank\texon\t" CP059040.gff | wc -l    #=12  16S and 23S ribosomal RNA
     grep -P "tRNAscan-SE\texon\t" CP059040.gff | wc -l    #tRNA 74
     wc -l star_salmon/AUM_r3/quant.genes.sf  #--featurecounts_feature_type 'transcript' results in 96 records!
    
     grep -P "\tCDS\t" CP059040.gff | wc -l  #3701
     sed 's/\tCDS\t/\texon\t/g' CP059040.gff > CP059040_m.gff
     grep -P "\texon\t" CP059040_m.gff | sort | wc -l  #3797
    
     # -- DEBUG_2: combination of 'CP059040_m.gff' and 'exon' results in ERROR, using 'transcript' instead!
     --gff "/home/jhuang/DATA/Data_Tam_RNAseq_2024/CP059040_m.gff" --featurecounts_feature_type 'transcript'
    
     # ---- SUCCESSFUL with directly downloaded gff3 and fasta from NCBI using docker after replacing 'CDS' with 'exon' ----
     mv trimmed/*.fq.gz .; rmdir trimmed
     (host_env) /usr/local/bin/nextflow run rnaseq/main.nf --input samplesheet.csv --outdir results    --fasta "/home/jhuang/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606/CP059040.fasta" --gff "/home/jhuang/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606/CP059040_m.gff"        -profile docker -resume  --max_cpus 90 --max_memory 900.GB --max_time 2400.h    --save_align_intermeds --save_unaligned --save_reference    --aligner 'star_salmon'    --gtf_group_features 'gene_id'  --gtf_extra_attributes 'gene_name' --featurecounts_group_type 'gene_biotype' --featurecounts_feature_type 'transcript'
    
     # -- DEBUG_3: make sure the header of fasta is the same to the *_m.gff file
  7. Prepare counts_fixed by hand: delete all “””, “gene-“, replace , to ‘\t’.

     cp ./results/star_salmon/gene_raw_counts.csv counts.tsv
    
     #keep only gene_id
     cut -f1 -d',' counts.tsv > f1
     cut -f3- -d',' counts.tsv > f3_
     paste -d',' f1 f3_ > counts_fixed.tsv
    
     Rscript rna_timecourse_bacteria.R \
       --counts counts_fixed.tsv \
       --samples samples.tsv \
       --condition_col condition \
       --time_col time_h \
       --emapper ~/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606/eggnog_out.emapper.annotations.txt \
       --volcano_csvs contrasts/ctrl_vs_treat.csv \
       --outdir results_bacteria
    
     #Delete the repliate 2 of ΔadeIJ_two_17 and repliate 1 of ΔadeIJ_two_24 are outlier.
     paste -d$'\t' f1_32 f34 f36_ > counts_fixed_2.tsv
    
     Rscript rna_timecourse_bacteria.R \
       --counts counts_fixed_2.tsv \
       --samples samples_2.tsv \
       --condition_col condition \
       --time_col time_h \
       --emapper ~/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606/eggnog_out.emapper.annotations.txt \
       --volcano_csvs contrasts/ctrl_vs_treat.csv \
       --outdir results_bacteria_2
  8. Import data and pca-plot

     #mamba activate r_env
    
     #install.packages("ggfun")
     # Import the required libraries
     library("AnnotationDbi")
     library("clusterProfiler")
     library("ReactomePA")
     library(gplots)
     library(tximport)
     library(DESeq2)
     #library("org.Hs.eg.db")
     library(dplyr)
     library(tidyverse)
     #install.packages("devtools")
     #devtools::install_version("gtable", version = "0.3.0")
     library(gplots)
     library("RColorBrewer")
     #install.packages("ggrepel")
     library("ggrepel")
     # install.packages("openxlsx")
     library(openxlsx)
     library(EnhancedVolcano)
     library(DESeq2)
     library(edgeR)
    
     setwd("~/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/results/star_salmon")
     # Define paths to your Salmon output quantification files
     files <- c("WT_17_r1" = "./WT_17_r1/quant.sf",
                "WT_17_r2" = "./WT_17_r2/quant.sf",
                "WT_17_r3" = "./WT_17_r3/quant.sf",
                "WT_24_r1" = "./WT_24_r1/quant.sf",
                "WT_24_r2" = "./WT_24_r2/quant.sf",
                "WT_24_r3" = "./WT_24_r3/quant.sf",
                "deltaIJ_17_r1" = "./deltaIJ_17_r1/quant.sf",
                "deltaIJ_17_r2" = "./deltaIJ_17_r2/quant.sf",
                "deltaIJ_17_r3" = "./deltaIJ_17_r3/quant.sf",
                "deltaIJ_24_r1" = "./deltaIJ_24_r1/quant.sf",
                "deltaIJ_24_r2" = "./deltaIJ_24_r2/quant.sf",
                "deltaIJ_24_r3" = "./deltaIJ_24_r3/quant.sf",
                "pre_WT_17_r1" = "./pre_WT_17_r1/quant.sf",
                "pre_WT_17_r2" = "./pre_WT_17_r2/quant.sf",
                "pre_WT_17_r3" = "./pre_WT_17_r3/quant.sf",
                "pre_WT_24_r1" = "./pre_WT_24_r1/quant.sf",
                "pre_WT_24_r2" = "./pre_WT_24_r2/quant.sf",
                "pre_WT_24_r3" = "./pre_WT_24_r3/quant.sf",
                "pre_deltaIJ_17_r1" = "./pre_deltaIJ_17_r1/quant.sf",
                "pre_deltaIJ_17_r2" = "./pre_deltaIJ_17_r2/quant.sf",
                "pre_deltaIJ_17_r3" = "./pre_deltaIJ_17_r3/quant.sf",
                "pre_deltaIJ_24_r1" = "./pre_deltaIJ_24_r1/quant.sf",
                "pre_deltaIJ_24_r2" = "./pre_deltaIJ_24_r2/quant.sf",
                "pre_deltaIJ_24_r3" = "./pre_deltaIJ_24_r3/quant.sf",
                "0_5_WT_17_r1" = "./0_5_WT_17_r1/quant.sf",
                "0_5_WT_17_r2" = "./0_5_WT_17_r2/quant.sf",
                "0_5_WT_17_r3" = "./0_5_WT_17_r3/quant.sf",
                "0_5_WT_24_r1" = "./0_5_WT_24_r1/quant.sf",
                "0_5_WT_24_r2" = "./0_5_WT_24_r2/quant.sf",
                "0_5_WT_24_r3" = "./0_5_WT_24_r3/quant.sf",
                "0_5_deltaIJ_17_r1" = "./0_5_deltaIJ_17_r1/quant.sf",
                "0_5_deltaIJ_17_r2" = "./0_5_deltaIJ_17_r2/quant.sf",
                "0_5_deltaIJ_17_r3" = "./0_5_deltaIJ_17_r3/quant.sf",
                "0_5_deltaIJ_24_r1" = "./0_5_deltaIJ_24_r1/quant.sf",
                "0_5_deltaIJ_24_r2" = "./0_5_deltaIJ_24_r2/quant.sf",
                "0_5_deltaIJ_24_r3" = "./0_5_deltaIJ_24_r3/quant.sf")
     # Import the transcript abundance data with tximport
     txi <- tximport(files, type = "salmon", txIn = TRUE, txOut = TRUE)
     # Define the replicates and condition of the samples
     replicate <- factor(c("r1", "r2", "r3",  "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3",     "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3",      "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3"))
     condition <- factor(c("WT_none_17","WT_none_17","WT_none_17","WT_none_24","WT_none_24","WT_none_24", "deltaadeIJ_none_17","deltaadeIJ_none_17","deltaadeIJ_none_17","deltaadeIJ_none_24","deltaadeIJ_none_24","deltaadeIJ_none_24",   "WT_one_17","WT_one_17","WT_one_17","WT_one_24","WT_one_24","WT_one_24", "deltaadeIJ_one_17","deltaadeIJ_one_17","deltaadeIJ_one_17","deltaadeIJ_one_24","deltaadeIJ_one_24","deltaadeIJ_one_24",   "WT_two_17","WT_two_17","WT_two_17","WT_two_24","WT_two_24","WT_two_24", "deltaadeIJ_two_17","deltaadeIJ_two_17","deltaadeIJ_two_17","deltaadeIJ_two_24","deltaadeIJ_two_24","deltaadeIJ_two_24"))
     # Construct colData manually
     colData <- data.frame(condition=condition, replicate=replicate, row.names=names(files))
     #dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition + batch)
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
    
     # -- Save the rlog-transformed counts --
     dim(counts(dds))
     head(counts(dds), 10)
     rld <- rlogTransformation(dds)
     rlog_counts <- assay(rld)
     write.xlsx(as.data.frame(rlog_counts), "gene_rlog_transformed_counts.xlsx")
    
     # -- pca --
     png("pca2.png", 1200, 800)
     plotPCA(rld, intgroup=c("condition"))
     dev.off()
    
     png("pca3.png", 1200, 800)
     plotPCA(rld, intgroup=c("replicate"))
     dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     # 1) keep only non-WT samples
     #pdat <- subset(pdat, !grepl("^WT_", condition))
     # drop unused factor levels so empty WT facets disappear
     pdat$condition <- droplevels(pdat$condition)
     # 2) pretty condition names: deltaadeIJ -> ΔadeIJ
     pdat$condition <- gsub("^deltaadeIJ", "\u0394adeIJ", pdat$condition)
     png("pca4.png", 1200, 800)
     ggplot(pdat, aes(PC1, PC2, color = replicate)) +
       geom_point(size = 3) +
       facet_wrap(~ condition) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     # Drop WT_* conditions from the data and from factor levels
     pdat <- subset(pdat, !grepl("^WT_", condition))
     pdat$condition <- droplevels(pdat$condition)
     # Prettify condition labels for the legend: deltaadeIJ -> ΔadeIJ
     pdat$condition <- gsub("^deltaadeIJ", "\u0394adeIJ", pdat$condition)
     p <- ggplot(pdat, aes(PC1, PC2, color = replicate, shape = condition)) +
       geom_point(size = 3) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     png("pca5.png", 1200, 800); print(p); dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     p_fac <- ggplot(pdat, aes(PC1, PC2, color = replicate)) +
       geom_point(size = 3) +
       facet_wrap(~ condition) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     png("pca6.png", 1200, 800); print(p_fac); dev.off()
    
     # -- heatmap --
     png("heatmap2.png", 1200, 800)
     distsRL <- dist(t(assay(rld)))
     mat <- as.matrix(distsRL)
     hc <- hclust(distsRL)
     hmcol <- colorRampPalette(brewer.pal(9,"GnBu"))(100)
     heatmap.2(mat, Rowv=as.dendrogram(hc),symm=TRUE, trace="none",col = rev(hmcol), margin=c(13, 13))
     dev.off()
    
     # -- pca_media_strain --
     #png("pca_media.png", 1200, 800)
     #plotPCA(rld, intgroup=c("media"))
     #dev.off()
     #png("pca_strain.png", 1200, 800)
     #plotPCA(rld, intgroup=c("strain"))
     #dev.off()
     #png("pca_time.png", 1200, 800)
     #plotPCA(rld, intgroup=c("time"))
     #dev.off()
  9. Select the differentially expressed genes

     #https://galaxyproject.eu/posts/2020/08/22/three-steps-to-galaxify-your-tool/
     #https://www.biostars.org/p/282295/
     #https://www.biostars.org/p/335751/
     dds$condition
     [1] WT_none_17         WT_none_17         WT_none_17         WT_none_24
     [5] WT_none_24         WT_none_24         deltaadeIJ_none_17 deltaadeIJ_none_17
     [9] deltaadeIJ_none_17 deltaadeIJ_none_24 deltaadeIJ_none_24 deltaadeIJ_none_24
     [13] WT_one_17          WT_one_17          WT_one_17          WT_one_24
     [17] WT_one_24          WT_one_24          deltaadeIJ_one_17  deltaadeIJ_one_17
     [21] deltaadeIJ_one_17  deltaadeIJ_one_24  deltaadeIJ_one_24  deltaadeIJ_one_24
     [25] WT_two_17          WT_two_17          WT_two_17          WT_two_24
     [29] WT_two_24          WT_two_24          deltaadeIJ_two_17  deltaadeIJ_two_17
     [33] deltaadeIJ_two_17  deltaadeIJ_two_24  deltaadeIJ_two_24  deltaadeIJ_two_24
     12 Levels: deltaadeIJ_none_17 deltaadeIJ_none_24 ... WT_two_24
    
     #CONSOLE: mkdir star_salmon/degenes
    
     setwd("degenes")
    
     # Construct colData automatically
     sample_table <- data.frame(
         condition = condition,
         replicate = replicate
     )
     split_cond <- do.call(rbind, strsplit(as.character(condition), "_"))
     colnames(split_cond) <- c("genotype", "exposure", "time")
     colData <- cbind(sample_table, split_cond)
     colData$genotype <- factor(colData$genotype)
     colData$exposure  <- factor(colData$exposure)
     colData$time   <- factor(colData$time)
     colData$group  <- factor(paste(colData$genotype, colData$exposure, colData$time, sep = "_"))
     # Construct colData manually
     colData2 <- data.frame(condition=condition, row.names=names(files))
    
     # 确保因子顺序(可选)
     colData$genotype <- relevel(factor(colData$genotype), ref = "WT")
     colData$exposure  <- relevel(factor(colData$exposure), ref = "none")
     colData$time   <- relevel(factor(colData$time), ref = "17")
    
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ genotype * exposure * time)
     dds <- DESeq(dds, betaPrior = FALSE)
     resultsNames(dds)
     [1] "Intercept"
     [2] "genotype_deltaadeIJ_vs_WT"
     [3] "exposure_one_vs_none"
     [4] "exposure_two_vs_none"
     [5] "time_24_vs_17"
     [6] "genotypedeltaadeIJ.exposureone"
     [7] "genotypedeltaadeIJ.exposuretwo"
     [8] "genotypedeltaadeIJ.time24"
     [9] "exposureone.time24"
     [10] "exposuretwo.time24"
     [11] "genotypedeltaadeIJ.exposureone.time24"
     [12] "genotypedeltaadeIJ.exposuretwo.time24"
    
     # 提取 genotype 的主效应: up 10, down 4
     contrast <- "genotype_deltaadeIJ_vs_WT"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 one exposure 的主效应: up 196; down 298
     contrast <- "exposure_one_vs_none"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 two exposure 的主效应: up 80; down 105
     contrast <- "exposure_two_vs_none"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 time 的主效应 up 10; down 2
     contrast <- "time_24_vs_17"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     #1.)  ΔadeIJ_none 17h vs WT_none 17h
     #2.)  ΔadeIJ_none 24h vs WT_none 24h
     #3.)  ΔadeIJ_one 17h vs WT_one 17h
     #4.)  ΔadeIJ_one 24h vs WT_one 24h
     #5.)  ΔadeIJ_two 17h vs WT_two 17h
     #6.)  ΔadeIJ_two 24h vs WT_two 24h
    
     #---- relevel to control ----
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
     dds$condition <- relevel(dds$condition, "WT_none_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_none_17_vs_WT_none_17")
    
     dds$condition <- relevel(dds$condition, "WT_none_24")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_none_24_vs_WT_none_24")
    
     dds$condition <- relevel(dds$condition, "WT_one_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_one_17_vs_WT_one_17")
    
     dds$condition <- relevel(dds$condition, "WT_one_24")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_one_24_vs_WT_one_24")
    
     dds$condition <- relevel(dds$condition, "WT_two_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_two_17_vs_WT_two_17")
    
     dds$condition <- relevel(dds$condition, "WT_two_24")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_two_24_vs_WT_two_24")
    
     # WT_none_xh
     dds$condition <- relevel(dds$condition, "WT_none_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_none_24_vs_WT_none_17")
    
     # WT_one_xh
     dds$condition <- relevel(dds$condition, "WT_one_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_one_24_vs_WT_one_17")
    
     # WT_two_xh
     dds$condition <- relevel(dds$condition, "WT_two_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_two_24_vs_WT_two_17")
    
     # deltaadeIJ_none_xh
     dds$condition <- relevel(dds$condition, "deltaadeIJ_none_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_none_24_vs_deltaadeIJ_none_17")
    
     # deltaadeIJ_one_xh
     dds$condition <- relevel(dds$condition, "deltaadeIJ_one_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_one_24_vs_deltaadeIJ_one_17")
    
     # deltaadeIJ_two_xh
     dds$condition <- relevel(dds$condition, "deltaadeIJ_two_17")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltaadeIJ_two_24_vs_deltaadeIJ_two_17")
    
     for (i in clist) {
       contrast = paste("condition", i, sep="_")
       #for_Mac_vs_LB  contrast = paste("media", i, sep="_")
       res = results(dds, name=contrast)
       res <- res[!is.na(res$log2FoldChange),]
       res_df <- as.data.frame(res)
    
       write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(i, "all.txt", sep="-"))
       #res$log2FoldChange < -2 & res$padj < 5e-2
       up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
       down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
       write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(i, "up.txt", sep="-"))
       write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(i, "down.txt", sep="-"))
     }
    
     # -- Under host-env (mamba activate plot-numpy1) --
     mamba activate plot-numpy1
     grep -P "\tgene\t" CP059040_m.gff > CP059040_gene.gff
    
     for cmp in deltaadeIJ_none_17_vs_WT_none_17 deltaadeIJ_none_24_vs_WT_none_24 deltaadeIJ_one_17_vs_WT_one_17 deltaadeIJ_one_24_vs_WT_one_24 deltaadeIJ_two_17_vs_WT_two_17 deltaadeIJ_two_24_vs_WT_two_24    WT_none_24_vs_WT_none_17 WT_one_24_vs_WT_one_17 WT_two_24_vs_WT_two_17 deltaadeIJ_none_24_vs_deltaadeIJ_none_17 deltaadeIJ_one_24_vs_deltaadeIJ_one_17 deltaadeIJ_two_24_vs_deltaadeIJ_two_17; do
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/CP059040_gene.gff ${cmp}-all.txt ${cmp}-all.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/CP059040_gene.gff ${cmp}-up.txt ${cmp}-up.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/CP059040_gene.gff ${cmp}-down.txt ${cmp}-down.csv
     done
     #deltaadeIJ_none_24_vs_deltaadeIJ_none_17  up(0) down(0)
     #deltaadeIJ_one_24_vs_deltaadeIJ_one_17    up(0) down(8: gabT, H0N29_11475, H0N29_01015, H0N29_01030, ...)
     #deltaadeIJ_two_24_vs_deltaadeIJ_two_17    up(8) down(51)
  10. (NOT_PERFORMED) Volcano plots

     # ---- delta sbp TSB 2h vs WT TSB 2h ----
     res <- read.csv("deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_2h_vs_WT_TSB_2h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_2h_vs_WT_TSB_2h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 2h versus WT TSB 2h"))
     dev.off()
    
     # ---- delta sbp TSB 4h vs WT TSB 4h ----
     res <- read.csv("deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_4h_vs_WT_TSB_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_4h_vs_WT_TSB_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 4h versus WT TSB 4h"))
     dev.off()
    
     # ---- delta sbp TSB 18h vs WT TSB 18h ----
     res <- read.csv("deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_18h_vs_WT_TSB_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_18h_vs_WT_TSB_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 18h versus WT TSB 18h"))
     dev.off()
    
     # ---- delta sbp MH 2h vs WT MH 2h ----
     res <- read.csv("deltasbp_MH_2h_vs_WT_MH_2h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_2h_vs_WT_MH_2h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_2h_vs_WT_MH_2h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 2h versus WT MH 2h"))
     dev.off()
    
     # ---- delta sbp MH 4h vs WT MH 4h ----
     res <- read.csv("deltasbp_MH_4h_vs_WT_MH_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_4h_vs_WT_MH_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_4h_vs_WT_MH_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 4h versus WT MH 4h"))
     dev.off()
    
     # ---- delta sbp MH 18h vs WT MH 18h ----
     res <- read.csv("deltasbp_MH_18h_vs_WT_MH_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_18h_vs_WT_MH_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_18h_vs_WT_MH_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 18h versus WT MH 18h"))
     dev.off()
    
     #Annotate the Gene_Expression_xxx_vs_yyy.xlsx in the next steps (see below e.g. Gene_Expression_with_Annotations_Urine_vs_MHB.xlsx)

KEGG and GO annotations in non-model organisms

https://www.biobam.com/functional-analysis/

Blast2GO_workflow

10.1. Assign KEGG and GO Terms (see diagram above)

    Since your organism is non-model, standard R databases (org.Hs.eg.db, etc.) won’t work. You’ll need to manually retrieve KEGG and GO annotations.

    Option 1 (KEGG Terms): EggNog based on orthology and phylogenies

        EggNOG-mapper assigns both KEGG Orthology (KO) IDs and GO terms.

        Install EggNOG-mapper:

            mamba create -n eggnog_env python=3.8 eggnog-mapper -c conda-forge -c bioconda  #eggnog-mapper_2.1.12
            mamba activate eggnog_env

        Run annotation:

            #diamond makedb --in eggnog6.prots.faa -d eggnog_proteins.dmnd
            mkdir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            download_eggnog_data.py --dbname eggnog.db -y --data_dir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            #NOT_WORKING: emapper.py -i CP020463_gene.fasta -o eggnog_dmnd_out --cpu 60 -m diamond[hmmer,mmseqs] --dmnd_db /home/jhuang/REFs/eggnog_data/data/eggnog_proteins.dmnd
            #Download the protein sequences from Genbank
            mv ~/Downloads/sequence\ \(3\).txt CP020463_protein_.fasta
            python ~/Scripts/update_fasta_header.py CP020463_protein_.fasta CP020463_protein.fasta
            emapper.py -i CP020463_protein.fasta -o eggnog_out --cpu 60  #--resume
            #----> result annotations.tsv: Contains KEGG, GO, and other functional annotations.
            #---->  470.IX87_14445:
                * 470 likely refers to the organism or strain (e.g., Acinetobacter baumannii ATCC 19606 or another related strain).
                * IX87_14445 would refer to a specific gene or protein within that genome.

        Extract KEGG KO IDs from annotations.emapper.annotations.

    Option 2 (GO Terms from 'Blast2GO 5 Basic', saved in blast2go_annot.annot): Using Blast/Diamond + Blast2GO_GUI based on sequence alignment + GO mapping

    * jhuang@WS-2290C:~/DATA/Data_Michelle_RNAseq_2025$ ~/Tools/Blast2GO/Blast2GO_Launcher setting the workspace "mkdir ~/b2gWorkspace_Michelle_RNAseq_2025"; cp /mnt/md1/DATA/Data_Michelle_RNAseq_2025/results/star_salmon/degenes/CP020463_protein.fasta ~/b2gWorkspace_Michelle_RNAseq_2025
    * 'Load protein sequences' (Tags: NONE, generated columns: Nr, SeqName) by choosing the file CP020463_protein.fasta as input -->
    * Buttons 'blast' at the NCBI (Parameters: blastp, nr, ...) (Tags: BLASTED, generated columns: Description, Length, #Hits, e-Value, sim mean),
            QBlast finished with warnings!
            Blasted Sequences: 2084
            Sequences without results: 105
            Check the Job log for details and try to submit again.
            Restarting QBlast may result in additional results, depending on the error type.
            "Blast (CP020463_protein) Done"
    * Button 'mapping' (Tags: MAPPED, generated columns: #GO, GO IDs, GO Names), "Mapping finished - Please proceed now to annotation."
            "Mapping (CP020463_protein) Done"
            "Mapping finished - Please proceed now to annotation."
    * Button 'annot' (Tags: ANNOTATED, generated columns: Enzyme Codes, Enzyme Names), "Annotation finished."
            * Used parameter 'Annotation CutOff': The Blast2GO Annotation Rule seeks to find the most specific GO annotations with a certain level of reliability. An annotation score is calculated for each candidate GO which is composed by the sequence similarity of the Blast Hit, the evidence code of the source GO and the position of the particular GO in the Gene Ontology hierarchy. This annotation score cutoff select the most specific GO term for a given GO branch which lies above this value.
            * Used parameter 'GO Weight' is a value which is added to Annotation Score of a more general/abstract Gene Ontology term for each of its more specific, original source GO terms. In this case, more general GO terms which summarise many original source terms (those ones directly associated to the Blast Hits) will have a higher Annotation Score.
            "Annotation (CP020463_protein) Done"
            "Annotation finished."
    or blast2go_cli_v1.5.1 (NOT_USED)

            #https://help.biobam.com/space/BCD/2250407989/Installation
            #see ~/Scripts/blast2go_pipeline.sh

    Option 3 (GO Terms from 'Blast2GO 5 Basic', saved in blast2go_annot.annot2): Interpro based protein families / domains --> Button interpro
        * Button 'interpro' (Tags: INTERPRO, generated columns: InterPro IDs, InterPro GO IDs, InterPro GO Names) --> "InterProScan Finished - You can now merge the obtained GO Annotations."
            "InterProScan (CP020463_protein) Done"
            "InterProScan Finished - You can now merge the obtained GO Annotations."
    MERGE the results of InterPro GO IDs (Option 3) to GO IDs (Option 2) and generate final GO IDs
        * Button 'interpro'/'Merge InterProScan GOs to Annotation' --> "Merge (add and validate) all GO terms retrieved via InterProScan to the already existing GO annotation."
            "Merge InterProScan GOs to Annotation (CP020463_protein) Done"
            "Finished merging GO terms from InterPro with annotations."
            "Maybe you want to run ANNEX (Annotation Augmentation)."
        #* Button 'annot'/'ANNEX' --> "ANNEX finished. Maybe you want to do the next step: Enzyme Code Mapping."
    File -> Export -> Export Annotations -> Export Annotations (.annot, custom, etc.)
            #~/b2gWorkspace_Michelle_RNAseq_2025/blast2go_annot.annot is generated!

        #-- before merging (blast2go_annot.annot) --
        #H0N29_18790     GO:0004842      ankyrin repeat domain-containing protein
        #H0N29_18790     GO:0085020
        #-- after merging (blast2go_annot.annot2) -->
        #H0N29_18790     GO:0031436      ankyrin repeat domain-containing protein
        #H0N29_18790     GO:0070531
        #H0N29_18790     GO:0004842
        #H0N29_18790     GO:0005515
        #H0N29_18790     GO:0085020

        cp blast2go_annot.annot blast2go_annot.annot2

    Option 4 (NOT_USED): RFAM for non-colding RNA

    Option 5 (NOT_USED): PSORTb for subcellular localizations

    Option 6 (NOT_USED): KAAS (KEGG Automatic Annotation Server)

    * Go to KAAS
    * Upload your FASTA file.
    * Select an appropriate gene set.
    * Download the KO assignments.

10.2. Find the Closest KEGG Organism Code (NOT_USED)

    Since your species isn't directly in KEGG, use a closely related organism.

    * Check available KEGG organisms:

            library(clusterProfiler)
            library(KEGGREST)

            kegg_organisms <- keggList("organism")

            Pick the closest relative (e.g., zebrafish "dre" for fish, Arabidopsis "ath" for plants).

            # Search for Acinetobacter in the list
            grep("Acinetobacter", kegg_organisms, ignore.case = TRUE, value = TRUE)
            # Gammaproteobacteria
            #Extract KO IDs from the eggnog results for  "Acinetobacter baumannii strain ATCC 19606"

10.3. Find the Closest KEGG Organism for a Non-Model Species (NOT_USED)

    If your organism is not in KEGG, search for the closest relative:

            grep("fish", kegg_organisms, ignore.case = TRUE, value = TRUE)  # Example search

    For KEGG pathway enrichment in non-model species, use "ko" instead of a species code (the code has been intergrated in the point 4):

            kegg_enrich <- enrichKEGG(gene = gene_list, organism = "ko")  # "ko" = KEGG Orthology

10.4. Perform KEGG and GO Enrichment in R (under dir ~/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/results/star_salmon/degenes)

        #BiocManager::install("GO.db")
        #BiocManager::install("AnnotationDbi")

        # Load required libraries
        library(openxlsx)  # For Excel file handling
        library(dplyr)     # For data manipulation
        library(tidyr)
        library(stringr)
        library(clusterProfiler)  # For KEGG and GO enrichment analysis
        #library(org.Hs.eg.db)  # Replace with appropriate organism database
        library(GO.db)
        library(AnnotationDbi)

        setwd("~/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/results/star_salmon/degenes")
        # PREPARING go_terms and ec_terms: annot_* file: cut -f1-2 -d$'\t' blast2go_annot.annot2 > blast2go_annot.annot2_
        # PREPARING eggnog_out.emapper.annotations.txt from eggnog_out.emapper.annotations by removing ## lines and renaming #query to query
        #(plot-numpy1) jhuang@WS-2290C:~/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606$ diff eggnog_out.emapper.annotations eggnog_out.emapper.annotations.txt
        #1,5c1
        #< ## Thu Jan 30 16:34:52 2025
        #< ## emapper-2.1.12
        #< ## /home/jhuang/mambaforge/envs/eggnog_env/bin/emapper.py -i CP059040_protein.fasta -o eggnog_out --cpu 60
        #< ##
        #< #query        seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway    KEGG_Module     KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #---
        #> query seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway   KEGG_Module      KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #3620,3622d3615
        #< ## 3614 queries scanned
        #< ## Total time (seconds): 8.176708459854126

        # Step 1: Load the blast2go annotation file with a check for missing columns
        annot_df <- read.table("/home/jhuang/b2gWorkspace_Tam_RNAseq_2024/blast2go_annot.annot2_", header = FALSE, sep = "\t", stringsAsFactors = FALSE, fill = TRUE)

        # If the structure is inconsistent, we can make sure there are exactly 3 columns:
        colnames(annot_df) <- c("GeneID", "Term")
        # Step 2: Filter and aggregate GO and EC terms as before
        go_terms <- annot_df %>%
        filter(grepl("^GO:", Term)) %>%
        group_by(GeneID) %>%
        summarize(GOs = paste(Term, collapse = ","), .groups = "drop")
        ec_terms <- annot_df %>%
        filter(grepl("^EC:", Term)) %>%
        group_by(GeneID) %>%
        summarize(EC = paste(Term, collapse = ","), .groups = "drop")

        # Key Improvements:
        #    * Looped processing of all 6 input files to avoid redundancy.
        #    * Robust handling of empty KEGG and GO enrichment results to prevent contamination of results between iterations.
        #    * File-safe output: Each dataset creates a separate Excel workbook with enriched sheets only if data exists.
        #    * Error handling for GO term descriptions via tryCatch.
        #    * Improved clarity and modular structure for easier maintenance and future additions.

        #file_name = "deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv"

        # ---------------------- Generated DEG(Annotated)_KEGG_GO_* -----------------------
        suppressPackageStartupMessages({
          library(readr)
          library(dplyr)
          library(stringr)
          library(tidyr)
          library(openxlsx)
          library(clusterProfiler)
          library(AnnotationDbi)
          library(GO.db)
        })

        # ---- PARAMETERS ----
        PADJ_CUT <- 5e-2
        LFC_CUT  <- 2

        # Your emapper annotations (with columns: query, GOs, EC, KEGG_ko, KEGG_Pathway, KEGG_Module, ... )
        emapper_path <- "~/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606/eggnog_out.emapper.annotations.txt"

        # Input files (you can add/remove here)
        input_files <- c(

        "deltaadeIJ_none_17_vs_WT_none_17-all.csv",  #up 11, down 3 vs. (10,4)
        "deltaadeIJ_none_24_vs_WT_none_24-all.csv",  #up 0, down 2 vs. (0,2)
        "deltaadeIJ_one_17_vs_WT_one_17-all.csv",    #up 238, down 90 vs. (239,89)  --> height 2600
        "deltaadeIJ_one_24_vs_WT_one_24-all.csv",    #up 83, down 64 vs. (64,71) --> height 1600
        "deltaadeIJ_two_17_vs_WT_two_17-all.csv",    #up 74, down 14 vs. (75,9) --> height 1000
        "deltaadeIJ_two_24_vs_WT_two_24-all.csv",    #up 1, down 3 vs. (3,3)

        "WT_none_24_vs_WT_none_17-all.csv",  #(up 10, down 2)
        "WT_one_24_vs_WT_one_17-all.csv",    #(up 97, down 3)
        "WT_two_24_vs_WT_two_17-all.csv",    #(up 12, down 1)

        "deltaadeIJ_two_24_vs_deltaadeIJ_two_17-all.csv",   #(up 8, down 51)
        "deltaadeIJ_one_24_vs_deltaadeIJ_one_17-all.csv",   #(up 0, down 10)
        "deltaadeIJ_none_24_vs_deltaadeIJ_none_17-all.csv" #(up 0, down 0)

        )

        # ---- HELPERS ----
        # Robust reader (CSV first, then TSV)
        read_table_any <- function(path) {
          tb <- tryCatch(readr::read_csv(path, show_col_types = FALSE),
                        error = function(e) tryCatch(readr::read_tsv(path, col_types = cols()),
                                                      error = function(e2) NULL))
          tb
        }

        # Return a nice Excel-safe base name
        xlsx_name_from_file <- function(path) {
          base <- tools::file_path_sans_ext(basename(path))
          paste0("DEG_KEGG_GO_", base, ".xlsx")
        }

        # KEGG expand helper: replace K-numbers with GeneIDs using mapping from the same result table
        expand_kegg_geneIDs <- function(kegg_res, mapping_tbl) {
          if (is.null(kegg_res) || nrow(as.data.frame(kegg_res)) == 0) return(data.frame())
          kdf <- as.data.frame(kegg_res)
          if (!"geneID" %in% names(kdf)) return(kdf)
          # mapping_tbl: columns KEGG_ko (possibly multiple separated by commas) and GeneID
          map_clean <- mapping_tbl %>%
            dplyr::select(KEGG_ko, GeneID) %>%
            filter(!is.na(KEGG_ko), KEGG_ko != "-") %>%
            mutate(KEGG_ko = str_remove_all(KEGG_ko, "ko:")) %>%
            tidyr::separate_rows(KEGG_ko, sep = ",") %>%
            distinct()

          if (!nrow(map_clean)) {
            return(kdf)
          }

          expanded <- kdf %>%
            tidyr::separate_rows(geneID, sep = "/") %>%
            dplyr::left_join(map_clean, by = c("geneID" = "KEGG_ko"), relationship = "many-to-many") %>%
            distinct() %>%
            dplyr::group_by(ID) %>%
            dplyr::summarise(across(everything(), ~ paste(unique(na.omit(.)), collapse = "/")), .groups = "drop")

          kdf %>%
            dplyr::select(-geneID) %>%
            dplyr::left_join(expanded %>% dplyr::select(ID, GeneID), by = "ID") %>%
            dplyr::rename(geneID = GeneID)
        }

        # ---- LOAD emapper annotations ----
        eggnog_data <- read.delim(emapper_path, header = TRUE, sep = "\t", quote = "", check.names = FALSE)
        # Ensure character columns for joins
        eggnog_data$query   <- as.character(eggnog_data$query)
        eggnog_data$GOs     <- as.character(eggnog_data$GOs)
        eggnog_data$EC      <- as.character(eggnog_data$EC)
        eggnog_data$KEGG_ko <- as.character(eggnog_data$KEGG_ko)

        # ---- MAIN LOOP ----
        for (f in input_files) {
          if (!file.exists(f)) { message("Missing: ", f); next }

          message("Processing: ", f)
          res <- read_table_any(f)
          if (is.null(res) || nrow(res) == 0) { message("Empty/unreadable: ", f); next }

          # Coerce expected columns if present
          if ("padj" %in% names(res))   res$padj <- suppressWarnings(as.numeric(res$padj))
          if ("log2FoldChange" %in% names(res)) res$log2FoldChange <- suppressWarnings(as.numeric(res$log2FoldChange))

          # Ensure GeneID & GeneName exist
          if (!"GeneID" %in% names(res)) {
            # Try to infer from a generic 'gene' column
            if ("gene" %in% names(res)) res$GeneID <- as.character(res$gene) else res$GeneID <- NA_character_
          }
          if (!"GeneName" %in% names(res)) res$GeneName <- NA_character_

          # Fill missing GeneName from GeneID (drop "gene-")
          res$GeneName <- ifelse(is.na(res$GeneName) | res$GeneName == "",
                                gsub("^gene-", "", as.character(res$GeneID)),
                                as.character(res$GeneName))

          # De-duplicate by GeneName, keep smallest padj
          if (!"padj" %in% names(res)) res$padj <- NA_real_
          res <- res %>%
            group_by(GeneName) %>%
            slice_min(padj, with_ties = FALSE) %>%
            ungroup() %>%
            as.data.frame()

          # Sort by padj asc, then log2FC desc
          if (!"log2FoldChange" %in% names(res)) res$log2FoldChange <- NA_real_
          res <- res[order(res$padj, -res$log2FoldChange), , drop = FALSE]

          # Join emapper (strip "gene-" from GeneID to match emapper 'query')
          res$GeneID_plain <- gsub("^gene-", "", res$GeneID)
          res_ann <- res %>%
            left_join(eggnog_data, by = c("GeneID_plain" = "query"))

          # --- Split by UP/DOWN using your volcano cutoffs ---
          up_regulated   <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange >  LFC_CUT)
          down_regulated <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange < -LFC_CUT)

          # --- KEGG enrichment (using K numbers in KEGG_ko) ---
          # Prepare KO lists (remove "ko:" if present)
          k_up <- up_regulated$KEGG_ko;   k_up <- k_up[!is.na(k_up)]
          k_dn <- down_regulated$KEGG_ko; k_dn <- k_dn[!is.na(k_dn)]
          k_up <- gsub("ko:", "", k_up);  k_dn <- gsub("ko:", "", k_dn)

          # BREAK_LINE

          kegg_up   <- tryCatch(enrichKEGG(gene = k_up, organism = "ko"), error = function(e) NULL)
          kegg_down <- tryCatch(enrichKEGG(gene = k_dn, organism = "ko"), error = function(e) NULL)

          # Convert KEGG K-numbers to your GeneIDs (using mapping from the same result set)
          kegg_up_df   <- expand_kegg_geneIDs(kegg_up,   up_regulated)
          kegg_down_df <- expand_kegg_geneIDs(kegg_down, down_regulated)

          # --- GO enrichment (custom TERM2GENE built from emapper GOs) ---
          # Background gene set = all genes in this comparison
          background_genes <- unique(res_ann$GeneID_plain)
          # TERM2GENE table (GO -> GeneID_plain)
          go_annotation <- res_ann %>%
            dplyr::select(GeneID_plain, GOs) %>%
            mutate(GOs = ifelse(is.na(GOs), "", GOs)) %>%
            tidyr::separate_rows(GOs, sep = ",") %>%
            filter(GOs != "") %>%
            dplyr::select(GOs, GeneID_plain) %>%
            distinct()

          # Gene lists for GO enricher
          go_list_up   <- unique(up_regulated$GeneID_plain)
          go_list_down <- unique(down_regulated$GeneID_plain)

          go_up <- tryCatch(
            enricher(gene = go_list_up, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )
          go_down <- tryCatch(
            enricher(gene = go_list_down, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )

          go_up_df   <- if (!is.null(go_up))   as.data.frame(go_up)   else data.frame()
          go_down_df <- if (!is.null(go_down)) as.data.frame(go_down) else data.frame()

          # Add GO term descriptions via GO.db (best-effort)
          add_go_term_desc <- function(df) {
            if (!nrow(df) || !"ID" %in% names(df)) return(df)
            df$Description <- sapply(df$ID, function(go_id) {
              term <- tryCatch(AnnotationDbi::select(GO.db, keys = go_id,
                                                    columns = "TERM", keytype = "GOID"),
                              error = function(e) NULL)
              if (!is.null(term) && nrow(term)) term$TERM[1] else NA_character_
            })
            df
          }
          go_up_df   <- add_go_term_desc(go_up_df)
          go_down_df <- add_go_term_desc(go_down_df)

          # ---- Write Excel workbook ----
          out_xlsx <- xlsx_name_from_file(f)
          wb <- createWorkbook()

          addWorksheet(wb, "Complete")
          writeData(wb, "Complete", res_ann)

          addWorksheet(wb, "Up_Regulated")
          writeData(wb, "Up_Regulated", up_regulated)

          addWorksheet(wb, "Down_Regulated")
          writeData(wb, "Down_Regulated", down_regulated)

          addWorksheet(wb, "KEGG_Enrichment_Up")
          writeData(wb, "KEGG_Enrichment_Up", kegg_up_df)

          addWorksheet(wb, "KEGG_Enrichment_Down")
          writeData(wb, "KEGG_Enrichment_Down", kegg_down_df)

          addWorksheet(wb, "GO_Enrichment_Up")
          writeData(wb, "GO_Enrichment_Up", go_up_df)

          addWorksheet(wb, "GO_Enrichment_Down")
          writeData(wb, "GO_Enrichment_Down", go_down_df)

          saveWorkbook(wb, out_xlsx, overwrite = TRUE)
          message("Saved: ", out_xlsx)
        }

        # -------------------------------- OLD_CODE not automatized with loop ----------------------------
        # Load the results
        res <- read.csv("deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv")
        res <- read.csv("deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv")
        res <- read.csv("deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv")
        res <- read.csv("deltasbp_MH_2h_vs_WT_MH_2h-all.csv")
        res <- read.csv("deltasbp_MH_4h_vs_WT_MH_4h-all.csv")
        res <- read.csv("deltasbp_MH_18h_vs_WT_MH_18h-all.csv")

        res <- read.csv("WT_MH_4h_vs_WT_MH_2h-all.csv")
        res <- read.csv("WT_MH_18h_vs_WT_MH_2h-all.csv")
        res <- read.csv("WT_MH_18h_vs_WT_MH_4h-all.csv")
        res <- read.csv("WT_TSB_4h_vs_WT_TSB_2h-all.csv")
        res <- read.csv("WT_TSB_18h_vs_WT_TSB_2h-all.csv")
        res <- read.csv("WT_TSB_18h_vs_WT_TSB_4h-all.csv")

        res <- read.csv("deltasbp_MH_4h_vs_deltasbp_MH_2h-all.csv")
        res <- read.csv("deltasbp_MH_18h_vs_deltasbp_MH_2h-all.csv")
        res <- read.csv("deltasbp_MH_18h_vs_deltasbp_MH_4h-all.csv")
        res <- read.csv("deltasbp_TSB_4h_vs_deltasbp_TSB_2h-all.csv")
        res <- read.csv("deltasbp_TSB_18h_vs_deltasbp_TSB_2h-all.csv")
        res <- read.csv("deltasbp_TSB_18h_vs_deltasbp_TSB_4h-all.csv")

        # Replace empty GeneName with modified GeneID
        res$GeneName <- ifelse(
            res$GeneName == "" | is.na(res$GeneName),
            gsub("gene-", "", res$GeneID),
            res$GeneName
        )

        # Remove duplicated genes by selecting the gene with the smallest padj
        duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]

        res <- res %>%
        group_by(GeneName) %>%
        slice_min(padj, with_ties = FALSE) %>%
        ungroup()

        res <- as.data.frame(res)
        # Sort res first by padj (ascending) and then by log2FoldChange (descending)
        res <- res[order(res$padj, -res$log2FoldChange), ]
        # Read eggnog annotations
        eggnog_data <- read.delim("~/DATA/Data_Michelle_RNAseq_2025/eggnog_out.emapper.annotations.txt", header = TRUE, sep = "\t")
        # Remove the "gene-" prefix from GeneID in res to match eggnog 'query' format
        res$GeneID <- gsub("gene-", "", res$GeneID)
        # Merge eggnog data with res based on GeneID
        res <- res %>% left_join(eggnog_data, by = c("GeneID" = "query"))

        # Merge with the res dataframe
        # Perform the left joins and rename columns
        res_updated <- res %>%
        left_join(go_terms, by = "GeneID") %>%
        left_join(ec_terms, by = "GeneID") %>% dplyr::select(-EC.x, -GOs.x) %>% dplyr::rename(EC = EC.y, GOs = GOs.y)

        # Filter up-regulated genes
        up_regulated <- res_updated[res_updated$log2FoldChange > 2 & res_updated$padj < 0.05, ]
        # Filter down-regulated genes
        down_regulated <- res_updated[res_updated$log2FoldChange < -2 & res_updated$padj < 0.05, ]

        # Create a new workbook
        wb <- createWorkbook()
        # Add the complete dataset as the first sheet (with annotations)
        addWorksheet(wb, "Complete")
        writeData(wb, "Complete_Data", res_updated)
        # Add the up-regulated genes as the second sheet (with annotations)
        addWorksheet(wb, "Up_Regulated")
        writeData(wb, "Up_Regulated", up_regulated)
        # Add the down-regulated genes as the third sheet (with annotations)
        addWorksheet(wb, "Down_Regulated")
        writeData(wb, "Down_Regulated", down_regulated)
        # Save the workbook to a file
        #saveWorkbook(wb, "Gene_Expression_with_Annotations_deltasbp_TSB_4h_vs_WT_TSB_4h.xlsx", overwrite = TRUE)
        #NOTE: The generated annotation-files contains all columns of DESeq2 (GeneName, GeneID, baseMean, log2FoldChange, lfcSE, stat, pvalue, padj) + almost all columns of eggNOG (GeneID, seed_ortholog, evalue, score, eggNOG_OGs, max_annot_lvl, COG_category, Description, Preferred_name, KEGG_ko, KEGG_Pathway, KEGG_Module, KEGG_Reaction, KEGG_rclass, BRITE, KEGG_TC, CAZy, BiGG_Reaction, PFAMs) except for -[GOs, EC] + two columns from Blast2GO (COs, EC); In the code below, we use the columns KEGG_ko and GOs for the KEGG and GO enrichments.

        #TODO: for Michelle's data, we can also perform both KEGG and GO enrichments.

        # Set GeneName as row names after the join
        rownames(res_updated) <- res_updated$GeneName
        res_updated <- res_updated %>% dplyr::select(-GeneName)
        ## Set the 'GeneName' column as row.names
        #rownames(res_updated) <- res_updated$GeneName
        ## Drop the 'GeneName' column since it's now the row names
        #res_updated$GeneName <- NULL
        # -- BREAK_1 --

        # ---- Perform KEGG enrichment analysis (up_regulated) ----
        gene_list_kegg_up <- up_regulated$KEGG_ko
        gene_list_kegg_up <- gsub("ko:", "", gene_list_kegg_up)
        kegg_enrichment_up <- enrichKEGG(gene = gene_list_kegg_up, organism = 'ko')
        # -- convert the GeneID (Kxxxxxx) to the true GeneID --
        # Step 0: Create KEGG to GeneID mapping
        kegg_to_geneid_up <- up_regulated %>%
        dplyr::select(KEGG_ko, GeneID) %>%
        filter(!is.na(KEGG_ko)) %>%  # Remove missing KEGG KO entries
        mutate(KEGG_ko = str_remove(KEGG_ko, "ko:"))  # Remove 'ko:' prefix if present
        # Step 1: Clean KEGG_ko values (separate multiple KEGG IDs)
        kegg_to_geneid_clean <- kegg_to_geneid_up %>%
        mutate(KEGG_ko = str_remove_all(KEGG_ko, "ko:")) %>%  # Remove 'ko:' prefixes
        separate_rows(KEGG_ko, sep = ",") %>%  # Ensure each KEGG ID is on its own row
        filter(KEGG_ko != "-") %>%  # Remove invalid KEGG IDs ("-")
        distinct()  # Remove any duplicate mappings
        # Step 2.1: Expand geneID column in kegg_enrichment_up
        expanded_kegg <- kegg_enrichment_up %>% as.data.frame() %>% separate_rows(geneID, sep = "/") %>%  left_join(kegg_to_geneid_clean, by = c("geneID" = "KEGG_ko"), relationship = "many-to-many") %>%  # Explicitly handle many-to-many
        distinct() %>%  # Remove duplicate matches
        group_by(ID) %>%
        summarise(across(everything(), ~ paste(unique(na.omit(.)), collapse = "/")), .groups = "drop")  # Re-collapse results
        #dplyr::glimpse(expanded_kegg)
        # Step 3.1: Replace geneID column in the original dataframe
        kegg_enrichment_up_df <- as.data.frame(kegg_enrichment_up)
        # Remove old geneID column and merge new one
        kegg_enrichment_up_df <- kegg_enrichment_up_df %>% dplyr::select(-geneID) %>%  left_join(expanded_kegg %>% dplyr::select(ID, GeneID), by = "ID") %>%  dplyr::rename(geneID = GeneID)  # Rename column back to geneID

        # ---- Perform KEGG enrichment analysis (down_regulated) ----
        # Step 1: Extract KEGG KO terms from down-regulated genes
        gene_list_kegg_down <- down_regulated$KEGG_ko
        gene_list_kegg_down <- gsub("ko:", "", gene_list_kegg_down)
        # Step 2: Perform KEGG enrichment analysis
        kegg_enrichment_down <- enrichKEGG(gene = gene_list_kegg_down, organism = 'ko')
        # --- Convert KEGG gene IDs (Kxxxxxx) to actual GeneIDs ---
        # Step 3: Create KEGG to GeneID mapping from down_regulated dataset
        kegg_to_geneid_down <- down_regulated %>%
        dplyr::select(KEGG_ko, GeneID) %>%
        filter(!is.na(KEGG_ko)) %>%  # Remove missing KEGG KO entries
        mutate(KEGG_ko = str_remove(KEGG_ko, "ko:"))  # Remove 'ko:' prefix if present
        # -- BREAK_2 --

        # Step 4: Clean KEGG_ko values (handle multiple KEGG IDs)
        kegg_to_geneid_down_clean <- kegg_to_geneid_down %>%
        mutate(KEGG_ko = str_remove_all(KEGG_ko, "ko:")) %>%  # Remove 'ko:' prefixes
        separate_rows(KEGG_ko, sep = ",") %>%  # Ensure each KEGG ID is on its own row
        filter(KEGG_ko != "-") %>%  # Remove invalid KEGG IDs ("-")
        distinct()  # Remove duplicate mappings

        # Step 5: Expand geneID column in kegg_enrichment_down
        expanded_kegg_down <- kegg_enrichment_down %>%
        as.data.frame() %>%
        separate_rows(geneID, sep = "/") %>%  # Split multiple KEGG IDs (Kxxxxx)
        left_join(kegg_to_geneid_down_clean, by = c("geneID" = "KEGG_ko"), relationship = "many-to-many") %>%  # Handle many-to-many mappings
        distinct() %>%  # Remove duplicate matches
        group_by(ID) %>%
        summarise(across(everything(), ~ paste(unique(na.omit(.)), collapse = "/")), .groups = "drop")  # Re-collapse results

        # Step 6: Replace geneID column in the original kegg_enrichment_down dataframe
        kegg_enrichment_down_df <- as.data.frame(kegg_enrichment_down) %>%
        dplyr::select(-geneID) %>%  # Remove old geneID column
        left_join(expanded_kegg_down %>% dplyr::select(ID, GeneID), by = "ID") %>%  # Merge new GeneID column
        dplyr::rename(geneID = GeneID)  # Rename column back to geneID
        # View the updated dataframe
        head(kegg_enrichment_down_df)

        # Create a new workbook
        #wb <- createWorkbook()
        # Save enrichment results to the workbook
        addWorksheet(wb, "KEGG_Enrichment_Up")
        writeData(wb, "KEGG_Enrichment_Up", as.data.frame(kegg_enrichment_up_df))
        # Save enrichment results to the workbook
        addWorksheet(wb, "KEGG_Enrichment_Down")
        writeData(wb, "KEGG_Enrichment_Down", as.data.frame(kegg_enrichment_down_df))

        # Define gene list (up-regulated genes)
        gene_list_go_up <- up_regulated$GeneID  # Extract the 149 up-regulated genes
        gene_list_go_down <- down_regulated$GeneID  # Extract the 65 down-regulated genes

        # Define background gene set (all genes in res)
        background_genes <- res_updated$GeneID  # Extract the 3646 background genes

        # Prepare GO annotation data from res
        go_annotation <- res_updated[, c("GOs","GeneID")]  # Extract relevant columns
        go_annotation <- go_annotation %>%
        tidyr::separate_rows(GOs, sep = ",")  # Split multiple GO terms into separate rows
        # -- BREAK_3 --

        go_enrichment_up <- enricher(
            gene = gene_list_go_up,                # Up-regulated genes
            TERM2GENE = go_annotation,       # Custom GO annotation
            pvalueCutoff = 0.05,             # Significance threshold
            pAdjustMethod = "BH",
            universe = background_genes      # Define the background gene set
        )
        go_enrichment_up <- as.data.frame(go_enrichment_up)

        go_enrichment_down <- enricher(
            gene = gene_list_go_down,                # Up-regulated genes
            TERM2GENE = go_annotation,       # Custom GO annotation
            pvalueCutoff = 0.05,             # Significance threshold
            pAdjustMethod = "BH",
            universe = background_genes      # Define the background gene set
        )
        go_enrichment_down <- as.data.frame(go_enrichment_down)

        ## Remove the 'p.adjust' column since no adjusted methods have been applied --> In this version we have used pvalue filtering (see above)!
        #go_enrichment_up <- go_enrichment_up[, !names(go_enrichment_up) %in% "p.adjust"]

        # Update the Description column with the term descriptions
        go_enrichment_up$Description <- sapply(go_enrichment_up$ID, function(go_id) {
        # Using select to get the term description
        term <- tryCatch({
            AnnotationDbi::select(GO.db, keys = go_id, columns = "TERM", keytype = "GOID")
        }, error = function(e) {
            message(paste("Error for GO term:", go_id))  # Print which GO ID caused the error
            return(data.frame(TERM = NA))  # In case of error, return NA
        })
        if (nrow(term) > 0) {
            return(term$TERM)
        } else {
            return(NA)  # If no description found, return NA
        }
        })
        ## Print the updated data frame
        #print(go_enrichment_up)

        ## Remove the 'p.adjust' column since no adjusted methods have been applied --> In this version we have used pvalue filtering (see above)!
        #go_enrichment_down <- go_enrichment_down[, !names(go_enrichment_down) %in% "p.adjust"]
        # Update the Description column with the term descriptions
        go_enrichment_down$Description <- sapply(go_enrichment_down$ID, function(go_id) {
        # Using select to get the term description
        term <- tryCatch({
            AnnotationDbi::select(GO.db, keys = go_id, columns = "TERM", keytype = "GOID")
        }, error = function(e) {
            message(paste("Error for GO term:", go_id))  # Print which GO ID caused the error
            return(data.frame(TERM = NA))  # In case of error, return NA
        })

        if (nrow(term) > 0) {
            return(term$TERM)
        } else {
            return(NA)  # If no description found, return NA
        }
        })

        addWorksheet(wb, "GO_Enrichment_Up")
        writeData(wb, "GO_Enrichment_Up", as.data.frame(go_enrichment_up))

        addWorksheet(wb, "GO_Enrichment_Down")
        writeData(wb, "GO_Enrichment_Down", as.data.frame(go_enrichment_down))

        # Save the workbook with enrichment results
        saveWorkbook(wb, "DEG_KEGG_GO_deltasbp_TSB_2h_vs_WT_TSB_2h.xlsx", overwrite = TRUE)

        #Error for GO term: GO:0006807: replace "GO:0006807 obsolete nitrogen compound metabolic process"
        #obsolete nitrogen compound metabolic process #https://www.ebi.ac.uk/QuickGO/term/GO:0006807
        #TODO: marked the color as yellow if the p.adjusted <= 0.05 in GO_enrichment!

        #mv KEGG_and_GO_Enrichments_Urine_vs_MHB.xlsx KEGG_and_GO_Enrichments_Mac_vs_LB.xlsx
        #Mac_vs_LB
        #LB.AB_vs_LB.WT19606
        #LB.IJ_vs_LB.WT19606
        #LB.W1_vs_LB.WT19606
        #LB.Y1_vs_LB.WT19606
        #Mac.AB_vs_Mac.WT19606
        #Mac.IJ_vs_Mac.WT19606
        #Mac.W1_vs_Mac.WT19606
        #Mac.Y1_vs_Mac.WT19606

        #TODO: write reply hints in KEGG_and_GO_Enrichments_deltasbp_TSB_4h_vs_WT_TSB_4h.xlsx contains icaABCD, gtf1 and gtf2.

10.5. (DEBUG) Draw the Venn diagram to compare the total DEGs across AUM, Urine, and MHB, irrespective of up- or down-regulation.

            library(openxlsx)

            # Function to read and clean gene ID files
            read_gene_ids <- function(file_path) {
            # Read the gene IDs from the file
            gene_ids <- readLines(file_path)

            # Remove any quotes and trim whitespaces
            gene_ids <- gsub('"', '', gene_ids)  # Remove quotes
            gene_ids <- trimws(gene_ids)  # Trim whitespaces

            # Remove empty entries or NAs
            gene_ids <- gene_ids[gene_ids != "" & !is.na(gene_ids)]

            return(gene_ids)
            }

            # Example list of LB files with both -up.id and -down.id for each condition
            lb_files_up <- c("LB.AB_vs_LB.WT19606-up.id", "LB.IJ_vs_LB.WT19606-up.id",
                            "LB.W1_vs_LB.WT19606-up.id", "LB.Y1_vs_LB.WT19606-up.id")
            lb_files_down <- c("LB.AB_vs_LB.WT19606-down.id", "LB.IJ_vs_LB.WT19606-down.id",
                            "LB.W1_vs_LB.WT19606-down.id", "LB.Y1_vs_LB.WT19606-down.id")

            # Combine both up and down files for each condition
            lb_files <- c(lb_files_up, lb_files_down)

            # Read gene IDs for each file in LB group
            #lb_degs <- setNames(lapply(lb_files, read_gene_ids), gsub("-(up|down).id", "", lb_files))
            lb_degs <- setNames(lapply(lb_files, read_gene_ids), make.unique(gsub("-(up|down).id", "", lb_files)))

            lb_degs_ <- list()
            combined_set <- c(lb_degs[["LB.AB_vs_LB.WT19606"]], lb_degs[["LB.AB_vs_LB.WT19606.1"]])
            #unique_combined_set <- unique(combined_set)
            lb_degs_$AB <- combined_set
            combined_set <- c(lb_degs[["LB.IJ_vs_LB.WT19606"]], lb_degs[["LB.IJ_vs_LB.WT19606.1"]])
            lb_degs_$IJ <- combined_set
            combined_set <- c(lb_degs[["LB.W1_vs_LB.WT19606"]], lb_degs[["LB.W1_vs_LB.WT19606.1"]])
            lb_degs_$W1 <- combined_set
            combined_set <- c(lb_degs[["LB.Y1_vs_LB.WT19606"]], lb_degs[["LB.Y1_vs_LB.WT19606.1"]])
            lb_degs_$Y1 <- combined_set

            # Example list of Mac files with both -up.id and -down.id for each condition
            mac_files_up <- c("Mac.AB_vs_Mac.WT19606-up.id", "Mac.IJ_vs_Mac.WT19606-up.id",
                            "Mac.W1_vs_Mac.WT19606-up.id", "Mac.Y1_vs_Mac.WT19606-up.id")
            mac_files_down <- c("Mac.AB_vs_Mac.WT19606-down.id", "Mac.IJ_vs_Mac.WT19606-down.id",
                            "Mac.W1_vs_Mac.WT19606-down.id", "Mac.Y1_vs_Mac.WT19606-down.id")

            # Combine both up and down files for each condition in Mac group
            mac_files <- c(mac_files_up, mac_files_down)

            # Read gene IDs for each file in Mac group
            mac_degs <- setNames(lapply(mac_files, read_gene_ids), make.unique(gsub("-(up|down).id", "", mac_files)))

            mac_degs_ <- list()
            combined_set <- c(mac_degs[["Mac.AB_vs_Mac.WT19606"]], mac_degs[["Mac.AB_vs_Mac.WT19606.1"]])
            mac_degs_$AB <- combined_set
            combined_set <- c(mac_degs[["Mac.IJ_vs_Mac.WT19606"]], mac_degs[["Mac.IJ_vs_Mac.WT19606.1"]])
            mac_degs_$IJ <- combined_set
            combined_set <- c(mac_degs[["Mac.W1_vs_Mac.WT19606"]], mac_degs[["Mac.W1_vs_Mac.WT19606.1"]])
            mac_degs_$W1 <- combined_set
            combined_set <- c(mac_degs[["Mac.Y1_vs_Mac.WT19606"]], mac_degs[["Mac.Y1_vs_Mac.WT19606.1"]])
            mac_degs_$Y1 <- combined_set

            # Function to clean sheet names to ensure no sheet name exceeds 31 characters
            truncate_sheet_name <- function(names_list) {
            sapply(names_list, function(name) {
            if (nchar(name) > 31) {
            return(substr(name, 1, 31))  # Truncate sheet name to 31 characters
            }
            return(name)
            })
            }

            # Assuming lb_degs_ is already a list of gene sets (LB.AB, LB.IJ, etc.)

            # Define intersections between different conditions for LB
            inter_lb_ab_ij <- intersect(lb_degs_$AB, lb_degs_$IJ)
            inter_lb_ab_w1 <- intersect(lb_degs_$AB, lb_degs_$W1)
            inter_lb_ab_y1 <- intersect(lb_degs_$AB, lb_degs_$Y1)
            inter_lb_ij_w1 <- intersect(lb_degs_$IJ, lb_degs_$W1)
            inter_lb_ij_y1 <- intersect(lb_degs_$IJ, lb_degs_$Y1)
            inter_lb_w1_y1 <- intersect(lb_degs_$W1, lb_degs_$Y1)

            # Define intersections between three conditions for LB
            inter_lb_ab_ij_w1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$W1))
            inter_lb_ab_ij_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$Y1))
            inter_lb_ab_w1_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$W1, lb_degs_$Y1))
            inter_lb_ij_w1_y1 <- Reduce(intersect, list(lb_degs_$IJ, lb_degs_$W1, lb_degs_$Y1))

            # Define intersection between all four conditions for LB
            inter_lb_ab_ij_w1_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$W1, lb_degs_$Y1))

            # Now remove the intersected genes from each original set for LB
            venn_list_lb <- list()

            # For LB.AB, remove genes that are also in other conditions
            venn_list_lb[["LB.AB_only"]] <- setdiff(lb_degs_$AB, union(inter_lb_ab_ij, union(inter_lb_ab_w1, inter_lb_ab_y1)))

            # For LB.IJ, remove genes that are also in other conditions
            venn_list_lb[["LB.IJ_only"]] <- setdiff(lb_degs_$IJ, union(inter_lb_ab_ij, union(inter_lb_ij_w1, inter_lb_ij_y1)))

            # For LB.W1, remove genes that are also in other conditions
            venn_list_lb[["LB.W1_only"]] <- setdiff(lb_degs_$W1, union(inter_lb_ab_w1, union(inter_lb_ij_w1, inter_lb_ab_w1_y1)))

            # For LB.Y1, remove genes that are also in other conditions
            venn_list_lb[["LB.Y1_only"]] <- setdiff(lb_degs_$Y1, union(inter_lb_ab_y1, union(inter_lb_ij_y1, inter_lb_ab_w1_y1)))

            # Add the intersections for LB (same as before)
            venn_list_lb[["LB.AB_AND_LB.IJ"]] <- inter_lb_ab_ij
            venn_list_lb[["LB.AB_AND_LB.W1"]] <- inter_lb_ab_w1
            venn_list_lb[["LB.AB_AND_LB.Y1"]] <- inter_lb_ab_y1
            venn_list_lb[["LB.IJ_AND_LB.W1"]] <- inter_lb_ij_w1
            venn_list_lb[["LB.IJ_AND_LB.Y1"]] <- inter_lb_ij_y1
            venn_list_lb[["LB.W1_AND_LB.Y1"]] <- inter_lb_w1_y1

            # Define intersections between three conditions for LB
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.W1"]] <- inter_lb_ab_ij_w1
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.Y1"]] <- inter_lb_ab_ij_y1
            venn_list_lb[["LB.AB_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ab_w1_y1
            venn_list_lb[["LB.IJ_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ij_w1_y1

            # Define intersection between all four conditions for LB
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ab_ij_w1_y1

            # Assuming mac_degs_ is already a list of gene sets (Mac.AB, Mac.IJ, etc.)

            # Define intersections between different conditions
            inter_mac_ab_ij <- intersect(mac_degs_$AB, mac_degs_$IJ)
            inter_mac_ab_w1 <- intersect(mac_degs_$AB, mac_degs_$W1)
            inter_mac_ab_y1 <- intersect(mac_degs_$AB, mac_degs_$Y1)
            inter_mac_ij_w1 <- intersect(mac_degs_$IJ, mac_degs_$W1)
            inter_mac_ij_y1 <- intersect(mac_degs_$IJ, mac_degs_$Y1)
            inter_mac_w1_y1 <- intersect(mac_degs_$W1, mac_degs_$Y1)

            # Define intersections between three conditions
            inter_mac_ab_ij_w1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$W1))
            inter_mac_ab_ij_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$Y1))
            inter_mac_ab_w1_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$W1, mac_degs_$Y1))
            inter_mac_ij_w1_y1 <- Reduce(intersect, list(mac_degs_$IJ, mac_degs_$W1, mac_degs_$Y1))

            # Define intersection between all four conditions
            inter_mac_ab_ij_w1_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$W1, mac_degs_$Y1))

            # Now remove the intersected genes from each original set
            venn_list_mac <- list()

            # For Mac.AB, remove genes that are also in other conditions
            venn_list_mac[["Mac.AB_only"]] <- setdiff(mac_degs_$AB, union(inter_mac_ab_ij, union(inter_mac_ab_w1, inter_mac_ab_y1)))

            # For Mac.IJ, remove genes that are also in other conditions
            venn_list_mac[["Mac.IJ_only"]] <- setdiff(mac_degs_$IJ, union(inter_mac_ab_ij, union(inter_mac_ij_w1, inter_mac_ij_y1)))

            # For Mac.W1, remove genes that are also in other conditions
            venn_list_mac[["Mac.W1_only"]] <- setdiff(mac_degs_$W1, union(inter_mac_ab_w1, union(inter_mac_ij_w1, inter_mac_ab_w1_y1)))

            # For Mac.Y1, remove genes that are also in other conditions
            venn_list_mac[["Mac.Y1_only"]] <- setdiff(mac_degs_$Y1, union(inter_mac_ab_y1, union(inter_mac_ij_y1, inter_mac_ab_w1_y1)))

            # Add the intersections (same as before)
            venn_list_mac[["Mac.AB_AND_Mac.IJ"]] <- inter_mac_ab_ij
            venn_list_mac[["Mac.AB_AND_Mac.W1"]] <- inter_mac_ab_w1
            venn_list_mac[["Mac.AB_AND_Mac.Y1"]] <- inter_mac_ab_y1
            venn_list_mac[["Mac.IJ_AND_Mac.W1"]] <- inter_mac_ij_w1
            venn_list_mac[["Mac.IJ_AND_Mac.Y1"]] <- inter_mac_ij_y1
            venn_list_mac[["Mac.W1_AND_Mac.Y1"]] <- inter_mac_w1_y1

            # Define intersections between three conditions
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.W1"]] <- inter_mac_ab_ij_w1
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.Y1"]] <- inter_mac_ab_ij_y1
            venn_list_mac[["Mac.AB_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ab_w1_y1
            venn_list_mac[["Mac.IJ_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ij_w1_y1

            # Define intersection between all four conditions
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ab_ij_w1_y1

            # Save the gene IDs to Excel for further inspection (optional)
            write.xlsx(lb_degs, file = "LB_DEGs.xlsx")
            write.xlsx(mac_degs, file = "Mac_DEGs.xlsx")

            # Clean sheet names and write the Venn intersection sets for LB and Mac groups into Excel files
            write.xlsx(venn_list_lb, file = "Venn_LB_Genes_Intersect.xlsx", sheetName = truncate_sheet_name(names(venn_list_lb)), rowNames = FALSE)
            write.xlsx(venn_list_mac, file = "Venn_Mac_Genes_Intersect.xlsx", sheetName = truncate_sheet_name(names(venn_list_mac)), rowNames = FALSE)

            # Venn Diagram for LB group
            venn1 <- ggvenn(lb_degs_,
                            fill_color = c("skyblue", "tomato", "gold", "orchid"),
                            stroke_size = 0.4,
                            set_name_size = 5)
            ggsave("Venn_LB_Genes.png", plot = venn1, width = 7, height = 7, dpi = 300)

            # Venn Diagram for Mac group
            venn2 <- ggvenn(mac_degs_,
                            fill_color = c("lightgreen", "slateblue", "plum", "orange"),
                            stroke_size = 0.4,
                            set_name_size = 5)
            ggsave("Venn_Mac_Genes.png", plot = venn2, width = 7, height = 7, dpi = 300)

            cat("✅ All Venn intersection sets exported to Excel successfully.\n")
  1. Clustering the genes and draw heatmap

    #http://xgenes.com/article/article-content/150/draw-venn-diagrams-using-matplotlib/
    #http://xgenes.com/article/article-content/276/go-terms-for-s-epidermidis/
    # save the Up-regulated and Down-regulated genes into -up.id and -down.id
    
    for i in deltaadeIJ_none_17_vs_WT_none_17 deltaadeIJ_none_24_vs_WT_none_24 deltaadeIJ_one_17_vs_WT_one_17 deltaadeIJ_one_24_vs_WT_one_24 deltaadeIJ_two_17_vs_WT_two_17 deltaadeIJ_two_24_vs_WT_two_24    WT_none_24_vs_WT_none_17 WT_one_24_vs_WT_one_17 WT_two_24_vs_WT_two_17 deltaadeIJ_none_24_vs_deltaadeIJ_none_17 deltaadeIJ_one_24_vs_deltaadeIJ_one_17 deltaadeIJ_two_24_vs_deltaadeIJ_two_17; do
      echo "cut -d',' -f1-1 ${i}-up.txt > ${i}-up.id";
      echo "cut -d',' -f1-1 ${i}-down.txt > ${i}-down.id";
    done
    
    #The row’s description column says “TsaE,” but the preferred_name is ydiB (shikimate/quinate dehydrogenase).
    #Length = 301 aa — that fits YdiB much better. TsaE (YjeE) is a small P-loop ATPase, typically ~150–170 aa, not ~300 aa.
    #The COG/orthology hit and the very strong e-value also point to a canonical enzyme rather than the tiny TsaE ATPase.
    #What likely happened
    #The “GeneName” (tsaE) was inherited from a prior/automated annotation.
    #Orthology mapping (preferred_name) recognizes the protein as YdiB; the free-text product line didn’t update, leaving a label clash.
    #What to do
    #Treat this locus as ydiB (shikimate dehydrogenase; aka AroE-II), not TsaE.
    #If you want to be thorough, BLAST the sequence and/or run InterPro/eggNOG: you should see SDR/oxidoreductase motifs for YdiB, not the P-loop NTPase (Walker A) you’d expect for TsaE.
    #Check your genome for the true t6A genes (tsaB/tsaD/tsaE/tsaC); the real tsaE should be a much smaller ORF.
    # -- Replace GeneName with Preferred_name when Preferred_name is non-empty and not '-' (first sheet). --
    # -- IMPORTANT_ADAPTION: the script by chaning "HJI06_" with "H0N29_"
    for i in deltaadeIJ_none_17_vs_WT_none_17 deltaadeIJ_none_24_vs_WT_none_24 deltaadeIJ_one_17_vs_WT_one_17 deltaadeIJ_one_24_vs_WT_one_24 deltaadeIJ_two_17_vs_WT_two_17 deltaadeIJ_two_24_vs_WT_two_24    WT_none_24_vs_WT_none_17 WT_one_24_vs_WT_one_17 WT_two_24_vs_WT_two_17 deltaadeIJ_none_24_vs_deltaadeIJ_none_17 deltaadeIJ_one_24_vs_deltaadeIJ_one_17 deltaadeIJ_two_24_vs_deltaadeIJ_two_17; do
      python ~/Scripts/replace_with_preferred_name.py DEG_KEGG_GO_${i}-all.xlsx -o ${i}-all_annotated.csv
    done
    
    # ------------------ Heatmap generation for two samples ----------------------
    
    ## ------------------------------------------------------------
    ## DEGs heatmap (dynamic GOI + dynamic column tags)
    ## Example contrast: deltasbp_TSB_2h_vs_WT_TSB_2h
    ## Assumes 'rld' (or 'vsd') is in the environment (DESeq2 transform)
    ## ------------------------------------------------------------
    
    #RUN rld generation code (see the first part of the file)
    setwd("degenes")
    ## 0) Config ---------------------------------------------------
    contrast <- "deltaadeIJ_none_17_vs_WT_none_17"  #up 11, down 3 vs. (10,4) --> height 600 heatmap_pattern1
    contrast <- "deltaadeIJ_none_24_vs_WT_none_24"  #up 0, down 2 vs. (0,2) --> height 600 pattern1
    contrast <- "deltaadeIJ_one_17_vs_WT_one_17"    #up 238, down 90 vs. (239,89)  --> height 4000 pattern2
    contrast <- "deltaadeIJ_one_24_vs_WT_one_24"    #up 83, down 64 vs. (64,71) --> height 1800 pattern2
    contrast <- "deltaadeIJ_two_17_vs_WT_two_17"    #up 74, down 14 vs. (75,9) --> height 1100 pattern2
    contrast <- "deltaadeIJ_two_24_vs_WT_two_24"    #up 1, down 3 vs. (3,3) --> height 600 pattern1
    
    contrast <- "WT_none_24_vs_WT_none_17"  #(up 10, down 2) --> height 600 pattern1
    contrast <- "WT_one_24_vs_WT_one_17"    #(up 97, down 3) --> height 1400 pattern2
    contrast <- "WT_two_24_vs_WT_two_17"    #(up 12, down 1) --> height 600 pattern1
    contrast <- "deltaadeIJ_none_24_vs_deltaadeIJ_none_17" #(up 0, down 0)
    contrast <- "deltaadeIJ_one_24_vs_deltaadeIJ_one_17"   #(up 0, down 10) --> height 600 pattern1
    contrast <- "deltaadeIJ_two_24_vs_deltaadeIJ_two_17"   #(up 8, down 51) --> height 1000 pattern2
    
    ## 1) Packages -------------------------------------------------
    need <- c("gplots")
    to_install <- setdiff(need, rownames(installed.packages()))
    if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org")
    suppressPackageStartupMessages(library(gplots))
    
    ## 2) Helpers --------------------------------------------------
    # Read IDs from a file that may be:
    #  - one column with or without header "Gene_Id"
    #  - may contain quotes
    read_ids_from_file <- function(path) {
      #path <- up_file
      if (!file.exists(path)) stop("File not found: ", path)
      df <- tryCatch(
        read.table(path, header = TRUE, stringsAsFactors = FALSE, quote = "\"'", comment.char = ""),
        error = function(e) NULL
      )
      if (!is.null(df) && ncol(df) >= 1) {
        if ("Gene_Id" %in% names(df)) {
          ids <- df[["Gene_Id"]]
        } else if (ncol(df) == 1L) {
          ids <- df[[1]]
        } else {
          first_nonempty <- which(colSums(df != "", na.rm = TRUE) > 0)[1]
          if (is.na(first_nonempty)) stop("No usable IDs in: ", path)
          ids <- df[[first_nonempty]]
        }
      } else {
        df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "")
        if (ncol(df2) < 1L) stop("No usable IDs in: ", path)
        ids <- df2[[1]]
      }
      ids <- trimws(gsub('"', "", ids))
      ids[nzchar(ids)]
    }
    
    #BREAK_LINE
    
    # From "A_vs_B" get c("A","B")
    split_contrast_groups <- function(x) {
      parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]]
      if (length(parts) != 2L) stop("Contrast must be in the form 'GroupA_vs_GroupB'")
      parts
    }
    
    # Match whole tags at boundaries or underscores
    match_tags <- function(nms, tags) {
      pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)")
      grepl(pat, nms, perl = TRUE)
    }
    
    ## 3) Expression matrix (DESeq2 rlog/vst) ----------------------
    # Use rld if present; otherwise try vsd
    if (exists("rld")) {
      expr_all <- assay(rld)
    } else if (exists("vsd")) {
      expr_all <- assay(vsd)
    } else {
      stop("Neither 'rld' nor 'vsd' object is available in the environment.")
    }
    RNASeq.NoCellLine <- as.matrix(expr_all)
    colnames(RNASeq.NoCellLine) <- c("WT_none_17_r1", "WT_none_17_r2", "WT_none_17_r3", "WT_none_24_r1", "WT_none_24_r2", "WT_none_24_r3", "deltaadeIJ_none_17_r1", "deltaadeIJ_none_17_r2", "deltaadeIJ_none_17_r3", "deltaadeIJ_none_24_r1", "deltaadeIJ_none_24_r2", "deltaadeIJ_none_24_r3", "WT_one_17_r1", "WT_one_17_r2", "WT_one_17_r3", "WT_one_24_r1", "WT_one_24_r2", "WT_one_24_r3", "deltaadeIJ_one_17_r1", "deltaadeIJ_one_17_r2", "deltaadeIJ_one_17_r3", "deltaadeIJ_one_24_r1", "deltaadeIJ_one_24_r2", "deltaadeIJ_one_24_r3", "WT_two_17_r1",      "WT_two_17_r2", "WT_two_17_r3", "WT_two_24_r1", "WT_two_24_r2", "WT_two_24_r3", "deltaadeIJ_two_17_r1", "deltaadeIJ_two_17_r2", "deltaadeIJ_two_17_r3", "deltaadeIJ_two_24_r1", "deltaadeIJ_two_24_r2", "deltaadeIJ_two_24_r3")
    
    # -- RUN the code with the new contract from HERE after first run --
    
    ## 4) Build GOI from the two .id files (Note that if empty not run!)-------------------------
    up_file   <- paste0(contrast, "-up.id")
    down_file <- paste0(contrast, "-down.id")
    GOI_up   <- read_ids_from_file(up_file)
    GOI_down <- read_ids_from_file(down_file)
    #GOI <- GOI_down
    GOI <- unique(c(GOI_up, GOI_down))
    if (length(GOI) == 0) stop("No gene IDs found in up/down .id files.")
    
    # GOI are already 'gene-*' in your data — use them directly for matching
    present <- intersect(rownames(RNASeq.NoCellLine), GOI)
    if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.")
    # Optional: report truly missing IDs (on the same 'gene-*' format)
    missing <- setdiff(GOI, present)
    if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.")
    
    ## 5) Keep ONLY columns for the two groups in the contrast -----
    groups <- split_contrast_groups(contrast)  # e.g., c("deltasbp_TSB_2h", "WT_TSB_2h")
    keep_cols <- match_tags(colnames(RNASeq.NoCellLine), groups)
    if (!any(keep_cols)) {
      stop("No columns matched the contrast groups: ", paste(groups, collapse = " and "),
          ". Check your column names or implement colData-based filtering.")
    }
    cols_idx <- which(keep_cols)
    sub_colnames <- colnames(RNASeq.NoCellLine)[cols_idx]
    
    # Put the second group first (e.g., WT first in 'deltasbp..._vs_WT...')
    ord <- order(!grepl(paste0("(^|_)", groups[2], "(_|$)"), sub_colnames, perl = TRUE))
    
    # Subset safely
    expr_sub <- RNASeq.NoCellLine[present, cols_idx, drop = FALSE][, ord, drop = FALSE]
    
    ## 6) Remove constant/NA rows ----------------------------------
    row_ok <- apply(expr_sub, 1, function(x) is.finite(sum(x)) && var(x, na.rm = TRUE) > 0)
    if (any(!row_ok)) message("Removing ", sum(!row_ok), " constant/NA rows.")
    datamat <- expr_sub[row_ok, , drop = FALSE]
    
    # Save the filtered matrix used for the heatmap (optional)
    out_mat <- paste0("DEGs_heatmap_expression_data_", contrast, ".txt")
    write.csv(as.data.frame(datamat), file = out_mat, quote = FALSE)
    
    #BREAK_LINE
    
    ## 7) Pretty labels (display only) ---------------------------
    # Start from rownames(datamat) (assumed to be GeneID)
    labRow_pretty <- rownames(datamat)
    # ---- Replace GeneID with GeneName from "
    -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty ‘ΔadeIJ’ and nicer spacing labCol_pretty <- colnames(datamat) labCol_pretty <- gsub("^deltaadeIJ", "\u0394adeIJ", labCol_pretty) labCol_pretty “WT TSB 2h r1” # If you prefer to drop replicate suffixes, uncomment: # labCol_pretty <- gsub(" r\\d+$", "", labCol_pretty) ## 8) Clustering ———————————————– # Row clustering with Pearson distance hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") #row_cor <- suppressWarnings(cor(t(datamat), method = "pearson", use = "pairwise.complete.obs")) #row_cor[!is.finite(row_cor)] <- 0 #hr <- hclust(as.dist(1 – row_cor), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.1) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] #BREAK_LINE labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty <- sub("^rna-", "", labRow_pretty) png(paste0("DEGs_heatmap_", contrast, ".png"), width=800, height=600) heatmap.2(datamat, Rowv = as.dendrogram(hr), col = bluered(75), scale = "row", RowSideColors = mycol, trace = "none", margin = c(10, 20), # bottom, left sepwidth = c(0, 0), dendrogram = 'row', Colv = 'false', density.info = 'none', labRow = labRow_pretty, # row labels WITHOUT "gene-" labCol = labCol_pretty, # col labels with Δsbp + spaces cexRow = 2.5, cexCol = 2.5, srtCol = 20, lhei = c(0.6, 4), # enlarge the first number when reduce the plot size to avoid the error 'Error in plot.new() : figure margins too large' lwid = c(0.8, 4)) # enlarge the first number when reduce the plot size to avoid the error 'Error in plot.new() : figure margins too large' dev.off() # DEBUG for some items starting with "gene-" labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty NOT_USED since no three time point comparison exists! #contrasts <- c( # "WT_MH_4h_vs_WT_MH_2h", # "WT_MH_18h_vs_WT_MH_2h", # "WT_MH_18h_vs_WT_MH_4h" #) ### Optionally force a condition display order (defaults to order of first appearance) #cond_order <- c("WT_MH_2h","WT_MH_4h","WT_MH_18h") ##cond_order <- NULL ## ——– 1) Packages ————————————— need <- c("gplots") to_install <- setdiff(need, rownames(installed.packages())) if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org") suppressPackageStartupMessages(library(gplots)) ## ——– 2) Helpers —————————————- read_ids_from_file <- function(path) { if (!file.exists(path)) stop("File not found: ", path) df = 1) { ids <- if ("Gene_Id" %in% names(df)) df[["Gene_Id"]] else df[[1]] } else { df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "") ids <- df2[[1]] } ids <- trimws(gsub('"', "", ids)) ids[nzchar(ids)] } # From "A_vs_B" return c("A","B") split_contrast_groups <- function(x) { parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]] if (length(parts) != 2L) stop("Contrast must be 'GroupA_vs_GroupB': ", x) parts } # Grep whole tag between start/end or underscores match_tags <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # Pretty labels for columns (optional tweaks) prettify_col_labels <- function(x) { x <- gsub("^deltaadeIJ", "\u0394adeIJ", x) # example from your earlier case x <- gsub("_", " ", x) x } # BREAK_LINE # — RUN the code with the new contract from HERE after first run — ## ——– 3) Build GOI (union across contrasts) ————- up_files <- paste0(contrasts, "-up.id") down_files <- paste0(contrasts, "-down.id") GOI <- unique(unlist(c( lapply(up_files, read_ids_from_file), lapply(down_files, read_ids_from_file) ))) if (!length(GOI)) stop("No gene IDs found in any up/down .id files for the given contrasts.") ## ——– 4) Expression matrix (rld or vsd) —————– if (exists("rld")) { expr_all <- assay(rld) } else if (exists("vsd")) { expr_all <- assay(vsd) } else { stop("Neither 'rld' nor 'vsd' object is available in the environment.") } expr_all <- as.matrix(expr_all) present <- intersect(rownames(expr_all), GOI) if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.") missing <- setdiff(GOI, present) if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.") ## ——– 5) Infer the THREE condition tags —————– pair_groups <- lapply(contrasts, split_contrast_groups) # list of c(A,B) cond_tags <- unique(unlist(pair_groups)) if (length(cond_tags) != 3L) { stop("Expected exactly three unique condition tags across the contrasts, got: ", paste(cond_tags, collapse = ", ")) } # If user provided an explicit order, use it; else keep first-appearance order if (!is.null(cond_order)) { if (!setequal(cond_order, cond_tags)) stop("cond_order must contain exactly these tags: ", paste(cond_tags, collapse = ", ")) cond_tags <- cond_order } #BREAK_LINE ## ——– 6) Subset columns to those 3 conditions ———– # helper: does a name contain any of the tags? match_any_tag <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # helper: return the specific tag that a single name matches detect_tag <- function(nm, tags) { hits <- vapply(tags, function(t) grepl(paste0("(^|_)", t, "(_|$)"), nm, perl = TRUE), logical(1)) if (!any(hits)) NA_character_ else tags[which(hits)[1]] } keep_cols <- match_any_tag(colnames(expr_all), cond_tags) if (!any(keep_cols)) { stop("No columns matched any of the three condition tags: ", paste(cond_tags, collapse = ", ")) } sub_idx <- which(keep_cols) sub_colnames <- colnames(expr_all)[sub_idx] # find the tag for each kept column (this is the part that was wrong before) cond_for_col <- vapply(sub_colnames, detect_tag, character(1), tags = cond_tags) # rank columns by your desired condition order, then by name within each condition cond_rank <- match(cond_for_col, cond_tags) ord <- order(cond_rank, sub_colnames) expr_sub <- expr_all[present, sub_idx, drop = FALSE][, ord, drop = FALSE] ## ——– 7) Remove constant/NA rows ———————— row_ok 0) if (any(!row_ok)) message(“Removing “, sum(!row_ok), ” constant/NA rows.”) datamat <- expr_sub[row_ok, , drop = FALSE] ## ——– 8) Labels —————————————- labRow_pretty <- rownames(datamat) # —- Replace GeneID with GeneName from " -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty <- make.unique(repl, sep = "_") } else { warning("Could not find GeneID/GeneName columns in ", all_path) } } else { warning("File not found: ", all_path) } labCol_pretty <- prettify_col_labels(colnames(datamat)) #BREAK_LINE ## ——– 9) Clustering (rows) —————————— hr <- hclust(as.dist(1 – cor(t(datamat), method = "pearson")), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.3) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] ## ——– 10) Save the matrix used ————————– out_tag <- paste(cond_tags, collapse = "_") write.csv(as.data.frame(datamat), file = paste0("DEGs_heatmap_expression_data_", out_tag, ".txt"), quote = FALSE) ## ——– 11) Plot heatmap ———————————- labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty ids #add Gene_Id in the first line, delete the “” #Note that using GeneID as index, rather than GeneName, since .txt contains only GeneID. GOI <- read.csv("ids")$Gene_Id RNASeq.NoCellLine <- assay(rld) #install.packages("gplots") library("gplots") #clustering methods: "ward.D", "ward.D2", "single", "complete", "average" (= UPGMA), "mcquitty" (= WPGMA), "median" (= WPGMC) or "centroid" (= UPGMC). pearson or spearman datamat = RNASeq.NoCellLine[GOI, ] #datamat = RNASeq.NoCellLine write.csv(as.data.frame(datamat), file ="DEGs_heatmap_expression_data.txt") constant_rows <- apply(datamat, 1, function(row) var(row) == 0) if(any(constant_rows)) { cat("Removing", sum(constant_rows), "constant rows.\n") datamat <- datamat[!constant_rows, ] } hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") hc <- hclust(as.dist(1-cor(datamat, method="spearman")), method="complete") mycl = cutree(hr, h=max(hr$height)/1.1) mycol = c("YELLOW", "BLUE", "ORANGE", "MAGENTA", "CYAN", "RED", "GREEN", "MAROON", "LIGHTBLUE", "PINK", "MAGENTA", "LIGHTCYAN", "LIGHTRED", "LIGHTGREEN"); mycol = mycol[as.vector(mycl)] png("DEGs_heatmap_deltasbp_TSB_2h_vs_WT_TSB_2h.png", width=1200, height=2000) heatmap.2(datamat, Rowv = as.dendrogram(hr), col = bluered(75), scale = "row", RowSideColors = mycol, trace = "none", margin = c(10, 15), # bottom, left sepwidth = c(0, 0), dendrogram = 'row', Colv = 'false', density.info = 'none', labRow = rownames(datamat), cexRow = 1.5, cexCol = 1.5, srtCol = 35, lhei = c(0.2, 4), # reduce top space (was 1 or more) lwid = c(0.4, 4)) # reduce left space (was 1 or more) dev.off() # ————– Cluster members —————- write.csv(names(subset(mycl, mycl == '1')),file='cluster1_YELLOW.txt') write.csv(names(subset(mycl, mycl == '2')),file='cluster2_DARKBLUE.txt') write.csv(names(subset(mycl, mycl == '3')),file='cluster3_DARKORANGE.txt') write.csv(names(subset(mycl, mycl == '4')),file='cluster4_DARKMAGENTA.txt') write.csv(names(subset(mycl, mycl == '5')),file='cluster5_DARKCYAN.txt') #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.txt -d',' -o DEGs_heatmap_cluster_members.xls #~/Tools/csv2xls-0.4/csv_to_xls.py DEGs_heatmap_expression_data.txt -d',' -o DEGs_heatmap_expression_data.xls; #### (NOT_WORKING) cluster members (adding annotations, note that it does not work for the bacteria, since it is not model-speices and we cannot use mart=ensembl) ##### subset_1<-names(subset(mycl, mycl == '1')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_1, ]) #2575 subset_2<-names(subset(mycl, mycl == '2')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_2, ]) #1855 subset_3<-names(subset(mycl, mycl == '3')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_3, ]) #217 subset_4<-names(subset(mycl, mycl == '4')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_4, ]) # subset_5<-names(subset(mycl, mycl == '5')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_5, ]) # # Initialize an empty data frame for the annotated data annotated_data <- data.frame() # Determine total number of genes total_genes <- length(rownames(data)) # Loop through each gene to annotate for (i in 1:total_genes) { gene <- rownames(data)[i] result 1) { result <- result[1, ] } # Check if the result is empty if (nrow(result) == 0) { result <- data.frame(ensembl_gene_id = gene, external_gene_name = NA, gene_biotype = NA, entrezgene_id = NA, chromosome_name = NA, start_position = NA, end_position = NA, strand = NA, description = NA) } # Transpose expression values expression_values <- t(data.frame(t(data[gene, ]))) colnames(expression_values) <- colnames(data) # Combine gene information and expression data combined_result <- cbind(result, expression_values) # Append to the final dataframe annotated_data <- rbind(annotated_data, combined_result) # Print progress every 100 genes if (i %% 100 == 0) { cat(sprintf("Processed gene %d out of %d\n", i, total_genes)) } } # Save the annotated data to a new CSV file write.csv(annotated_data, "cluster1_YELLOW.csv", row.names=FALSE) write.csv(annotated_data, "cluster2_DARKBLUE.csv", row.names=FALSE) write.csv(annotated_data, "cluster3_DARKORANGE.csv", row.names=FALSE) write.csv(annotated_data, "cluster4_DARKMAGENTA.csv", row.names=FALSE) write.csv(annotated_data, "cluster5_DARKCYAN.csv", row.names=FALSE) #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.csv -d',' -o DEGs_heatmap_clusters.xls

Processing Data_JuliaFuchs_RNAseq_2025 v3

  1. Targets

     > Which genes are differentially expressed between the conditions for each time point.
     > Also, from our pulldown experiment, we identified several potential
     > target genes, and I’d be particularly interested to see if there are
     > expression changes for those in the RNA-seq data. I’ll include the
     > list of targets below once it’s ready.
     简要结论:莫西沙星(Moxifloxacin)= 抗生素;丝裂霉素C(Mitomycin C)= 临床上不作为抗感染用抗生素。
     莫西沙星(Moxifloxacin):第四代氟喹诺酮类抗生素,用于治疗细菌感染(如呼吸道、皮肤等)。作用机制是抑制DNA旋转酶和拓扑异构酶IV,阻断细菌DNA复制。
     丝裂霉素C(Mitomycin C):本质上是来源于链霉菌的一类“抗肿瘤抗生素”,通过烷基化DNA 造成交联破坏,因此主要用于肿瘤化疗,以及少数局部应用(眼科/耳鼻喉科术中抑制瘢痕增生等)。尽管名字里有“抗生素”,也确有抗菌活性,但全身毒性过大,不用于治疗感染。
    
     > Additionally, I have a specific question regarding the toxin–antitoxin
     > system I’m studying. The toxin and antitoxin genes are:
     >
     > Toxin:
     > ttatttacaatgcctcttgatccatgtctcaattccctcaagagtaagatttttgtcgtttactactcttaaagtaaactgaaccgcttcatcttgagtgcattcaaaattaatactatttaacttcaaaaatattaccatagatgtaaaagctgttcttttattcgcattatggaatgcgtgcttttgagctatatttctatatataaaagctgcttttctctcgattgtttcatatagttcaactccaccgaatgattgtttaactccttcaatagtagcattaagaacttctggaactttaacaccaacttgttcttttggtgagaaatcttgtattgcttttacattaatggcaatcacttgtttttcagttaaatatttagtgctttgcat
     >
     > Antitoxin:
     > ttataagtcaaccatcctttttaaagcttggttatactcagtgaatgtttcatccaacaatttaaaaaactcctcgtcctctcttacctccttttcgatggttactttattatcttttacattaaatttaagattatcaccatttgatattccgagtgctgcgatcacttctgtcggtacagaaacaactgaactattaccagcttttcttagttttcttgtagtaatcat
     >
     > I’m wondering whether you can check if these two genes might share the
     > same promoter and whether any RNA-seq signal supports their
     > co-expression.
  2. Download and prepare raw data

     # ---- Dataset_1 ----
     aws configure
     > Aws_access_key_id:AKIAYWZZRVKWTQDI4CHT
     > Aws_secret_access_key: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
     >
     >
     aws s3 cp s3://staefgap-598731762349/ ./ --recursive  #S3 Bucket
    
     # ---- Dataset_2 ----
     aws configure
     > Aws_access_key_id:AKIAYWZZRVKWXL5FYUBC
     > Aws_secret_access_key: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
     >
     >
     aws s3 cp s3://stavoupp-598731762349/ ./ --recursive  #S3 Bucket
    
     mkdir raw_data; cd raw_data
    
     ln -s ../F25A430001462_STAvoupP/1a_untreated_4h/1a_untreated_4h_1.fq.gz Untreated_4h_1a_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1a_untreated_4h/1a_untreated_4h_2.fq.gz Untreated_4h_1a_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1b_untreated_4h/1b_untreated_4h_1.fq.gz Untreated_4h_1b_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1b_untreated_4h/1b_untreated_4h_2.fq.gz Untreated_4h_1b_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1c_untreated_4h/1c_untreated_4h_1.fq.gz Untreated_4h_1c_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1c_untreated_4h/1c_untreated_4h_2.fq.gz Untreated_4h_1c_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1d_untreated_8h/1d_untreated_8h_1.fq.gz Untreated_8h_1d_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1d_untreated_8h/1d_untreated_8h_2.fq.gz Untreated_8h_1d_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1e_untreated_8h/1e_untreated_8h_1.fq.gz Untreated_8h_1e_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1e_untreated_8h/1e_untreated_8h_2.fq.gz Untreated_8h_1e_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1f_untreated_8h/1f_untreated_8h_1.fq.gz Untreated_8h_1f_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1f_untreated_8h/1f_untreated_8h_2.fq.gz Untreated_8h_1f_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1g_untreated18h/1g_untreated18h_1.fq.gz Untreated_18h_1g_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1g_untreated18h/1g_untreated18h_2.fq.gz Untreated_18h_1g_R2.fastq.gz
     ln -s ../F25A430001462_STAefgaP/1h_untreated18h/1h_untreated18h_1.fq.gz Untreated_18h_1h_R1.fastq.gz
     ln -s ../F25A430001462_STAefgaP/1h_untreated18h/1h_untreated18h_2.fq.gz Untreated_18h_1h_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1i_untreated18h/1i_untreated18h_1.fq.gz Untreated_18h_1i_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/1i_untreated18h/1i_untreated18h_2.fq.gz Untreated_18h_1i_R2.fastq.gz
    
     ln -s ../F25A430001462_STAvoupP/2a_Mitomycin_4h/2a_Mitomycin_4h_1.fq.gz Mitomycin_4h_2a_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2a_Mitomycin_4h/2a_Mitomycin_4h_2.fq.gz Mitomycin_4h_2a_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2b_Mitomycin_4h/2b_Mitomycin_4h_1.fq.gz Mitomycin_4h_2b_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2b_Mitomycin_4h/2b_Mitomycin_4h_2.fq.gz Mitomycin_4h_2b_R2.fastq.gz
     ln -s ../F25A430001462_STAefgaP/2c_Mitomycin_4h/2c_Mitomycin_4h_1.fq.gz Mitomycin_4h_2c_R1.fastq.gz
     ln -s ../F25A430001462_STAefgaP/2c_Mitomycin_4h/2c_Mitomycin_4h_2.fq.gz Mitomycin_4h_2c_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2d_Mitomycin_8h/2d_Mitomycin_8h_1.fq.gz Mitomycin_8h_2d_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2d_Mitomycin_8h/2d_Mitomycin_8h_2.fq.gz Mitomycin_8h_2d_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2e_Mitomycin_8h/2e_Mitomycin_8h_1.fq.gz Mitomycin_8h_2e_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2e_Mitomycin_8h/2e_Mitomycin_8h_2.fq.gz Mitomycin_8h_2e_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2f_Mitomycin_8h/2f_Mitomycin_8h_1.fq.gz Mitomycin_8h_2f_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2f_Mitomycin_8h/2f_Mitomycin_8h_2.fq.gz Mitomycin_8h_2f_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2g_Mitomycin18h/2g_Mitomycin18h_1.fq.gz Mitomycin_18h_2g_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2g_Mitomycin18h/2g_Mitomycin18h_2.fq.gz Mitomycin_18h_2g_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2h_Mitomycin18h/2h_Mitomycin18h_1.fq.gz Mitomycin_18h_2h_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2h_Mitomycin18h/2h_Mitomycin18h_2.fq.gz Mitomycin_18h_2h_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2i_Mitomycin18h/2i_Mitomycin18h_1.fq.gz Mitomycin_18h_2i_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/2i_Mitomycin18h/2i_Mitomycin18h_2.fq.gz Mitomycin_18h_2i_R2.fastq.gz
    
     ln -s ../F25A430001462_STAvoupP/3a_Moxi_4h/3a_Moxi_4h_1.fq.gz Moxi_4h_3a_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3a_Moxi_4h/3a_Moxi_4h_2.fq.gz Moxi_4h_3a_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3b_Moxi_4h/3b_Moxi_4h_1.fq.gz Moxi_4h_3b_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3b_Moxi_4h/3b_Moxi_4h_2.fq.gz Moxi_4h_3b_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3c_Moxi_4h/3c_Moxi_4h_1.fq.gz Moxi_4h_3c_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3c_Moxi_4h/3c_Moxi_4h_2.fq.gz Moxi_4h_3c_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3d_Moxi_8h/3d_Moxi_8h_1.fq.gz Moxi_8h_3d_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3d_Moxi_8h/3d_Moxi_8h_2.fq.gz Moxi_8h_3d_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3e_Moxi_8h/3e_Moxi_8h_1.fq.gz Moxi_8h_3e_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3e_Moxi_8h/3e_Moxi_8h_2.fq.gz Moxi_8h_3e_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3f_Moxi_8h/3f_Moxi_8h_1.fq.gz Moxi_8h_3f_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3f_Moxi_8h/3f_Moxi_8h_2.fq.gz Moxi_8h_3f_R2.fastq.gz
     ln -s ../F25A430001462_STAefgaP/3g_Moxi_18h/3g_Moxi_18h_1.fq.gz Moxi_18h_3g_R1.fastq.gz
     ln -s ../F25A430001462_STAefgaP/3g_Moxi_18h/3g_Moxi_18h_2.fq.gz Moxi_18h_3g_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3h_Moxi_18h/3h_Moxi_18h_1.fq.gz Moxi_18h_3h_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3h_Moxi_18h/3h_Moxi_18h_2.fq.gz Moxi_18h_3h_R2.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3i_Moxi_18h/3i_Moxi_18h_1.fq.gz Moxi_18h_3i_R1.fastq.gz
     ln -s ../F25A430001462_STAvoupP/3i_Moxi_18h/3i_Moxi_18h_2.fq.gz Moxi_18h_3i_R2.fastq.gz
  3. Preparing the directory trimmed

     mkdir trimmed trimmed_unpaired;
     for sample_id in Untreated_4h_1a Untreated_4h_1a Untreated_4h_1b Untreated_4h_1b Untreated_4h_1c Untreated_4h_1c Untreated_8h_1d Untreated_8h_1d Untreated_8h_1e Untreated_8h_1e Untreated_8h_1f Untreated_8h_1f Untreated_18h_1g Untreated_18h_1g Untreated_18h_1h Untreated_18h_1h Untreated_18h_1i Untreated_18h_1i  Mitomycin_4h_2a Mitomycin_4h_2a Mitomycin_4h_2b Mitomycin_4h_2b Mitomycin_4h_2c Mitomycin_4h_2c Mitomycin_8h_2d Mitomycin_8h_2d Mitomycin_8h_2e Mitomycin_8h_2e Mitomycin_8h_2f Mitomycin_8h_2f Mitomycin_18h_2g Mitomycin_18h_2g Mitomycin_18h_2h Mitomycin_18h_2h Mitomycin_18h_2i Mitomycin_18h_2i  Moxi_4h_3a Moxi_4h_3a Moxi_4h_3b Moxi_4h_3b Moxi_4h_3c Moxi_4h_3c Moxi_8h_3d Moxi_8h_3d Moxi_8h_3e Moxi_8h_3e Moxi_8h_3f Moxi_8h_3f Moxi_18h_3g Moxi_18h_3g Moxi_18h_3h Moxi_18h_3h Moxi_18h_3i Moxi_18h_3i; do
             java -jar /home/jhuang/Tools/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 100 raw_data/${sample_id}_R1.fastq.gz raw_data/${sample_id}_R2.fastq.gz trimmed/${sample_id}_R1.fastq.gz trimmed_unpaired/${sample_id}_R1.fastq.gz trimmed/${sample_id}_R2.fastq.gz trimmed_unpaired/${sample_id}_R2.fastq.gz ILLUMINACLIP:/home/jhuang/Tools/Trimmomatic-0.36/adapters/TruSeq3-PE-2.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:20; done 2> trimmomatic_pe.log;
     done
     mv trimmed/*.fastq.gz .
  4. Preparing samplesheet.csv

     sample,fastq_1,fastq_2,strandedness
     Untreated_4h_1a,Untreated_4h_1a_R1.fastq.gz,Untreated_4h_1a_R2.fastq.gz,auto
     Untreated_4h_1a,Untreated_4h_1a_R1.fastq.gz,Untreated_4h_1a_R2.fastq.gz,auto
     ...
  5. nextflow run

     #See an example: http://xgenes.com/article/article-content/157/prepare-virus-gtf-for-nextflow-run/
     #docker pull nfcore/rnaseq
     ln -s /home/jhuang/Tools/nf-core-rnaseq-3.12.0/ rnaseq
    
     # -- DEBUG_1 (CDS --> exon in CP052959.gff) --
     grep -P "\texon\t" CP052959.gff | sort | wc -l    #=81
     grep -P "cmsearch\texon\t" CP052959.gff | wc -l   #=10  signal recognition particle sRNA small typ, transfer-messenger RNA, 5S ribosomal RNA
     grep -P "Genbank\texon\t" CP052959.gff | wc -l    #=10  16S and 23S ribosomal RNA
     grep -P "tRNAscan-SE\texon\t" CP052959.gff | wc -l    #61  tRNA
     grep -P "\tCDS\t" CP052959.gff | wc -l  #2581
     sed 's/\tCDS\t/\texon\t/g' CP052959.gff > CP052959_m.gff
     grep -P "\texon\t" CP052959_m.gff | sort | wc -l  #2662 (81 more comparing with 'CDS')
    
     # -- NOTE that combination of 'CP052959_m.gff' and 'exon' in the command will result in ERROR, using 'transcript' instead in the command line!
     --gff "/home/jhuang/DATA/Data_Tam_RNAseq_2024/CP052959_m.gff" --featurecounts_feature_type 'transcript'
    
     # ---- SUCCESSFUL with directly downloaded gff3 and fasta from NCBI using docker after replacing 'CDS' with 'exon' ----
     (host_env) /usr/local/bin/nextflow run rnaseq/main.nf --input samplesheet.csv --outdir results    --fasta "/home/jhuang/DATA/Data_JuliaFuchs_RNAseq/CP052959.fasta" --gff "/home/jhuang/DATA/Data_JuliaFuchs_RNAseq/CP052959_m.gff"        -profile docker -resume  --max_cpus 100 --max_memory 512.GB --max_time 2400.h    --save_align_intermeds --save_unaligned --save_reference    --aligner 'star_salmon'    --gtf_group_features 'gene_id'  --gtf_extra_attributes 'gene_name' --featurecounts_group_type 'gene_biotype' --featurecounts_feature_type 'transcript'
    
     # -- DEBUG_3: make sure the header of fasta is the same to the *_m.gff file, both are "CP052959.1"
  6. Generate advanced PCA-plot

     cp ./results/star_salmon/gene_raw_counts.csv counts.tsv
    
     #keep only gene_id
     cut -f1 -d',' counts.tsv > f1
     cut -f3- -d',' counts.tsv > f3_
     paste -d',' f1 f3_ > counts_fixed.tsv
    
     #IMPORTANT_EDIT:  delete all """, "gene-", replace ',' to '\t' in counts_fixed.tsv.
     #IMPORTANT_ENV: mamba activate r_env
     #IMPORTANT_NOTE: rownames of samples.tsv and columns of counts.tsv should algin!!!!
     Rscript rna_timecourse_bacteria.R \
       --counts counts_fixed.tsv \
       --samples samples.tsv \
       --condition_col condition \
       --time_col time_h \
       --emapper ~/DATA/Data_JuliaFuchs_RNAseq_2025/eggnog_out.emapper.annotations.txt \
       --volcano_csvs contrasts/ctrl_vs_treat.csv \
       --outdir results_bacteria
  7. Import data and pca-plot

     #mamba activate r_env
    
     #install.packages("ggfun")
     # Import the required libraries
     library("AnnotationDbi")
     library("clusterProfiler")
     library("ReactomePA")
     library(gplots)
     library(tximport)
     library(DESeq2)
     #library("org.Hs.eg.db")
     library(dplyr)
     library(tidyverse)
     #install.packages("devtools")
     #devtools::install_version("gtable", version = "0.3.0")
     library(gplots)
     library("RColorBrewer")
     #install.packages("ggrepel")
     library("ggrepel")
     # install.packages("openxlsx")
     library(openxlsx)
     library(EnhancedVolcano)
     library(DESeq2)
     library(edgeR)
    
     setwd("~/DATA/Data_JuliaFuchs_RNAseq_2025/results/star_salmon")
     # Define paths to your Salmon output quantification files
    
     files <- c("Untreated_4h_r1" = "./Untreated_4h_1a/quant.sf",
                "Untreated_4h_r2" = "./Untreated_4h_1b/quant.sf",
                "Untreated_4h_r3" = "./Untreated_4h_1c/quant.sf",
                "Untreated_8h_r1" = "./Untreated_8h_1d/quant.sf",
                "Untreated_8h_r2" = "./Untreated_8h_1e/quant.sf",
                "Untreated_8h_r3" = "./Untreated_8h_1f/quant.sf",
                "Untreated_18h_r1" = "./Untreated_18h_1g/quant.sf",
                "Untreated_18h_r2" = "./Untreated_18h_1h/quant.sf",
                "Untreated_18h_r3" = "./Untreated_18h_1i/quant.sf",
                "Mitomycin_4h_r1" = "./Mitomycin_4h_2a/quant.sf",
                "Mitomycin_4h_r2" = "./Mitomycin_4h_2b/quant.sf",
                "Mitomycin_4h_r3" = "./Mitomycin_4h_2c/quant.sf",
                "Mitomycin_8h_r1" = "./Mitomycin_8h_2d/quant.sf",
                "Mitomycin_8h_r2" = "./Mitomycin_8h_2e/quant.sf",
                "Mitomycin_8h_r3" = "./Mitomycin_8h_2f/quant.sf",
                "Mitomycin_18h_r1" = "./Mitomycin_18h_2g/quant.sf",
                "Mitomycin_18h_r2" = "./Mitomycin_18h_2h/quant.sf",
                "Mitomycin_18h_r3" = "./Mitomycin_18h_2i/quant.sf",
                "Moxi_4h_r1" = "./Moxi_4h_3a/quant.sf",
                "Moxi_4h_r2" = "./Moxi_4h_3b/quant.sf",
                "Moxi_4h_r3" = "./Moxi_4h_3c/quant.sf",
                "Moxi_8h_r1" = "./Moxi_8h_3d/quant.sf",
                "Moxi_8h_r2" = "./Moxi_8h_3e/quant.sf",
                "Moxi_8h_r3" = "./Moxi_8h_3f/quant.sf",
                "Moxi_18h_r1" = "./Moxi_18h_3g/quant.sf",
                "Moxi_18h_r2" = "./Moxi_18h_3h/quant.sf",
                "Moxi_18h_r3" = "./Moxi_18h_3i/quant.sf")
     # Import the transcript abundance data with tximport
     txi <- tximport(files, type = "salmon", txIn = TRUE, txOut = TRUE)
     # Define the replicates and condition of the samples
     replicate <- factor(c("r1", "r2", "r3",  "r1", "r2", "r3", "r1", "r2", "r3",    "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3",       "r1", "r2", "r3", "r1", "r2", "r3", "r1", "r2", "r3"))
     condition <- factor(c("Untreated_4h","Untreated_4h","Untreated_4h","Untreated_8h","Untreated_8h","Untreated_8h","Untreated_18h","Untreated_18h","Untreated_18h", "Mitomycin_4h","Mitomycin_4h","Mitomycin_4h","Mitomycin_8h","Mitomycin_8h","Mitomycin_8h","Mitomycin_18h","Mitomycin_18h","Mitomycin_18h", "Moxi_4h","Moxi_4h","Moxi_4h","Moxi_8h","Moxi_8h","Moxi_8h","Moxi_18h","Moxi_18h","Moxi_18h"))
     # Construct colData manually
     colData <- data.frame(condition=condition, replicate=replicate, row.names=names(files))
     #dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition + batch)
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
    
     # -- Save the rlog-transformed counts --
     dim(counts(dds))
     head(counts(dds), 10)
     rld <- rlogTransformation(dds)
     rlog_counts <- assay(rld)
     write.xlsx(as.data.frame(rlog_counts), "gene_rlog_transformed_counts.xlsx")
    
     # -- pca --
     png("pca2.png", 1200, 800)
     plotPCA(rld, intgroup=c("condition"))
     dev.off()
    
     png("pca3.png", 1200, 800)
     plotPCA(rld, intgroup=c("replicate"))
     dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     # 1) keep only non-WT samples
     #pdat <- subset(pdat, !grepl("^WT_", condition))
     # drop unused factor levels so empty WT facets disappear
     pdat$condition <- droplevels(pdat$condition)
     # 2) pretty condition names: deltaadeIJ -> ΔadeIJ
     pdat$condition <- gsub("^deltasbp", "\u0394sbp", pdat$condition)
     png("pca4.png", 1200, 800)
     ggplot(pdat, aes(PC1, PC2, color = replicate)) +
       geom_point(size = 3) +
       facet_wrap(~ condition) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     # Drop WT_* conditions from the data and from factor levels
     pdat <- subset(pdat, !grepl("^WT_", condition))
     pdat$condition <- droplevels(pdat$condition)
     # Prettify condition labels for the legend: deltaadeIJ -> ΔadeIJ
     pdat$condition <- gsub("^deltasbp", "\u0394sbp", pdat$condition)
     p <- ggplot(pdat, aes(PC1, PC2, color = replicate, shape = condition)) +
       geom_point(size = 3) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     png("pca5.png", 1200, 800); print(p); dev.off()
    
     pdat <- plotPCA(rld, intgroup = c("condition","replicate"), returnData = TRUE)
     percentVar <- round(100 * attr(pdat, "percentVar"))
     p_fac <- ggplot(pdat, aes(PC1, PC2, color = replicate)) +
       geom_point(size = 3) +
       facet_wrap(~ condition) +
       xlab(paste0("PC1: ", percentVar[1], "% variance")) +
       ylab(paste0("PC2: ", percentVar[2], "% variance")) +
       theme_classic()
     png("pca6.png", 1200, 800); print(p_fac); dev.off()
    
     # -- heatmap --
     png("heatmap2.png", 1200, 800)
     distsRL <- dist(t(assay(rld)))
     mat <- as.matrix(distsRL)
     hc <- hclust(distsRL)
     hmcol <- colorRampPalette(brewer.pal(9,"GnBu"))(100)
     heatmap.2(mat, Rowv=as.dendrogram(hc),symm=TRUE, trace="none",col = rev(hmcol), margin=c(13, 13))
     dev.off()
    
     # -- pca_media_strain --
     #png("pca_media.png", 1200, 800)
     #plotPCA(rld, intgroup=c("media"))
     #dev.off()
     #png("pca_strain.png", 1200, 800)
     #plotPCA(rld, intgroup=c("strain"))
     #dev.off()
     #png("pca_time.png", 1200, 800)
     #plotPCA(rld, intgroup=c("time"))
     #dev.off()
    
     # ------------------------
     # 1️⃣ Setup and input files
     # ------------------------
    
     # Read in transcript-to-gene mapping
     tx2gene <- read.table("salmon_tx2gene.tsv", header=FALSE, stringsAsFactors=FALSE)
     colnames(tx2gene) <- c("transcript_id", "gene_id", "gene_name")
    
     # Prepare tx2gene for gene-level summarization (remove gene_name if needed)
     tx2gene_geneonly <- tx2gene[, c("transcript_id", "gene_id")]
    
     # --------------------------------
     # 4️⃣ Raw counts table (with gene names)
     # --------------------------------
     # Extract raw gene-level counts
     counts_data <- as.data.frame(counts(dds, normalized=FALSE))
     counts_data$gene_id <- rownames(counts_data)
    
     # Add gene names
     tx2gene_unique <- unique(tx2gene[, c("gene_id", "gene_name")])
     counts_data <- merge(counts_data, tx2gene_unique, by="gene_id", all.x=TRUE)
    
     # Reorder columns: gene_id, gene_name, then counts
     count_cols <- setdiff(colnames(counts_data), c("gene_id", "gene_name"))
     counts_data <- counts_data[, c("gene_id", "gene_name", count_cols)]
    
     # --------------------------------
     # 5️⃣ Calculate CPM
     # --------------------------------
     library(edgeR)
     library(openxlsx)
    
     # Prepare count matrix for CPM calculation
     count_matrix <- as.matrix(counts_data[, !(colnames(counts_data) %in% c("gene_id", "gene_name"))])
    
     # Calculate CPM
     #cpm_matrix <- cpm(count_matrix, normalized.lib.sizes=FALSE)
     total_counts <- colSums(count_matrix)
     cpm_matrix <- t(t(count_matrix) / total_counts) * 1e6
     cpm_matrix <- as.data.frame(cpm_matrix)
    
     # Add gene_id and gene_name back to CPM table
     cpm_counts <- cbind(counts_data[, c("gene_id", "gene_name")], cpm_matrix)
    
     # --------------------------------
     # 6️⃣ Save outputs
     # --------------------------------
     write.csv(counts_data, "gene_raw_counts.csv", row.names=FALSE)
     write.xlsx(counts_data, "gene_raw_counts.xlsx", row.names=FALSE)
     write.xlsx(cpm_counts, "gene_cpm_counts.xlsx", row.names=FALSE)
  8. Select the differentially expressed genes

     #https://galaxyproject.eu/posts/2020/08/22/three-steps-to-galaxify-your-tool/
     #https://www.biostars.org/p/282295/
     #https://www.biostars.org/p/335751/
     dds$condition
     #  [1] Untreated_4h  Untreated_4h  Untreated_4h  Untreated_8h  Untreated_8h
     #  [6] Untreated_8h  Untreated_18h Untreated_18h Untreated_18h Mitomycin_4h
     #  [11] Mitomycin_4h  Mitomycin_4h  Mitomycin_8h  Mitomycin_8h  Mitomycin_8h
     #  [16] Mitomycin_18h Mitomycin_18h Mitomycin_18h Moxi_4h       Moxi_4h
     #  [21] Moxi_4h       Moxi_8h       Moxi_8h       Moxi_8h       Moxi_18h
     #  [26] Moxi_18h      Moxi_18h
     #  9 Levels: Mitomycin_18h Mitomycin_4h Mitomycin_8h Moxi_18h Moxi_4h ... Untreated_8h
    
     #CONSOLE: mkdir star_salmon/degenes
    
     setwd("degenes")
    
     # Construct colData automatically
     sample_table <- data.frame(
         condition = condition,
         replicate = replicate
     )
     split_cond <- do.call(rbind, strsplit(as.character(condition), "_"))
     #colnames(split_cond) <- c("genotype", "exposure", "time")
     colnames(split_cond) <- c("genotype", "time")
     colData <- cbind(sample_table, split_cond)
     colData$genotype <- factor(colData$genotype)
     #colData$exposure  <- factor(colData$exposure)
     colData$time   <- factor(colData$time)
     #colData$group  <- factor(paste(colData$genotype, colData$exposure, colData$time, sep = "_"))
     colData$group  <- factor(paste(colData$genotype, colData$time, sep = "_"))
     colData2 <- data.frame(condition=condition, row.names=names(files))
    
     # 确保因子顺序(可选)
     colData$genotype <- relevel(factor(colData$genotype), ref = "Untreated")
     #colData$exposure  <- relevel(factor(colData$exposure), ref = "none")
     colData$time   <- relevel(factor(colData$time), ref = "4h")
    
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ genotype * time)
     dds <- DESeq(dds, betaPrior = FALSE)
     resultsNames(dds)
     #[1] "Intercept"                       "genotype_Mitomycin_vs_Untreated"
     #[3] "genotype_Moxi_vs_Untreated"      "time_18h_vs_4h"
     #[5] "time_8h_vs_4h"                   "genotypeMitomycin.time18h"
     #[7] "genotypeMoxi.time18h"            "genotypeMitomycin.time8h"
     #[9] "genotypeMoxi.time8h"
    
     #Mitomycin(丝裂霉素)通常特指丝裂霉素C(Mitomycin C, MMC),是一类来自放线菌(Streptomyces)的抗肿瘤抗生素。它在体内被还原后转化为活性烷化剂,可与DNA发生交联,阻断复制与转录,从而抑制细胞增殖。
     #一句话理解:Mitomycin C 是一种能让DNA“粘住”的抗癌药,既可全身化疗,也常被医生小剂量局部用来防止疤痕组织长回来。
     # 提取 genotype 的主效应: up 489, down 67
     contrast <- "genotype_Mitomycin_vs_Untreated"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     #莫西沙星(Moxifloxacin)是一种第四代氟喹诺酮类抗生素,常见商品名如 Avelox(口服/静脉)与 Vigamox(0.5% 眼用滴剂)。
     #作用机制: 抑制细菌的DNA 回旋酶(DNA gyrase)和拓扑异构酶 IV,阻断细菌 DNA 复制与修复,属杀菌作用。
     # 提取 genotype 的主效应: up 349, down 118
     contrast <- "genotype_Moxi_vs_Untreated"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 time 的主效应 up 262; down 51
     contrast <- "time_18h_vs_4h"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 time 的主效应 up 90; down 18
     contrast <- "time_8h_vs_4h"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     colData$genotype <- relevel(factor(colData$genotype), ref = "Moxi")
     colData$time   <- relevel(factor(colData$time), ref = "8h")
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ genotype * time)
     dds <- DESeq(dds, betaPrior = FALSE)
     resultsNames(dds)
     #[1] "Intercept"                  "genotype_Untreated_vs_Moxi"
     #[3] "genotype_Mitomycin_vs_Moxi" "time_4h_vs_8h"
     #[5] "time_18h_vs_8h"             "genotypeUntreated.time4h"
     #[7] "genotypeMitomycin.time4h"   "genotypeUntreated.time18h"
     #[9] "genotypeMitomycin.time18h"
    
     # 提取 genotype 的主效应: up 361, down 6
     contrast <- "genotype_Mitomycin_vs_Moxi"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 time 的主效应 up 15; down 3
     contrast <- "time_18h_vs_8h"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     #1.)  Moxi_4h_vs_Untreated_4h
     #2.)  Mitomycin_4h_vs_Untreated_4h
     #3.)  Moxi_8h_vs_Untreated_8h
     #4.)  Mitomycin_8h_vs_Untreated_8h
     #5.)  Moxi_18h_vs_Untreated_18h
     #6.)  Mitomycin_18h_vs_Untreated_18h
    
     #---- relevel to control ----
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
     dds$condition <- relevel(dds$condition, "Untreated_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Moxi_4h_vs_Untreated_4h", "Mitomycin_4h_vs_Untreated_4h")
    
     dds$condition <- relevel(dds$condition, "Untreated_8h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Moxi_8h_vs_Untreated_8h", "Mitomycin_8h_vs_Untreated_8h")
    
     dds$condition <- relevel(dds$condition, "Untreated_18h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Moxi_18h_vs_Untreated_18h", "Mitomycin_18h_vs_Untreated_18h")
    
     # Mitomycin_xh
     dds$condition <- relevel(dds$condition, "Mitomycin_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Mitomycin_18h_vs_Mitomycin_4h", "Mitomycin_8h_vs_Mitomycin_4h")
    
     dds$condition <- relevel(dds$condition, "Mitomycin_8h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Mitomycin_18h_vs_Mitomycin_8h")
    
     # Moxi_xh
     dds$condition <- relevel(dds$condition, "Moxi_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Moxi_18h_vs_Moxi_4h", "Moxi_8h_vs_Moxi_4h")
    
     dds$condition <- relevel(dds$condition, "Moxi_8h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Moxi_18h_vs_Moxi_8h")
    
     # Untreated_xh
     dds$condition <- relevel(dds$condition, "Untreated_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Untreated_18h_vs_Untreated_4h", "Untreated_8h_vs_Untreated_4h")
    
     dds$condition <- relevel(dds$condition, "Untreated_8h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("Untreated_18h_vs_Untreated_8h")
    
     for (i in clist) {
       contrast = paste("condition", i, sep="_")
       #for_Mac_vs_LB  contrast = paste("media", i, sep="_")
       res = results(dds, name=contrast)
       res <- res[!is.na(res$log2FoldChange),]
       res_df <- as.data.frame(res)
    
       write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(i, "all.txt", sep="-"))
       #res$log2FoldChange < -2 & res$padj < 5e-2
       up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
       down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
       write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(i, "up.txt", sep="-"))
       write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(i, "down.txt", sep="-"))
     }
    
     # -- Under host-env (mamba activate plot-numpy1) --
     mamba activate plot-numpy1
     grep -P "\tgene\t" CP052959_m.gff > CP052959_gene.gff
    
     #NOTE that the script replace_gene_names.py was improved with a single fallback rule: after the initial mapping, any still empty/NA GeneName will be filled with the GeneID stripped of the gene-/rna- prefix. Nothing else changes.
     for cmp in Mitomycin_18h_vs_Untreated_18h Mitomycin_8h_vs_Untreated_8h Mitomycin_4h_vs_Untreated_4h Moxi_18h_vs_Untreated_18h Moxi_8h_vs_Untreated_8h Moxi_4h_vs_Untreated_4h Mitomycin_18h_vs_Mitomycin_4h Mitomycin_18h_vs_Mitomycin_8h Mitomycin_8h_vs_Mitomycin_4h  Moxi_18h_vs_Moxi_4h Moxi_18h_vs_Moxi_8h Moxi_8h_vs_Moxi_4h  Untreated_18h_vs_Untreated_4h Untreated_18h_vs_Untreated_8h Untreated_8h_vs_Untreated_4h; do
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_JuliaFuchs_RNAseq_2025/CP052959_gene.gff ${cmp}-all.txt ${cmp}-all.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_JuliaFuchs_RNAseq_2025/CP052959_gene.gff ${cmp}-up.txt ${cmp}-up.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_JuliaFuchs_RNAseq_2025/CP052959_gene.gff ${cmp}-down.txt ${cmp}-down.csv
     done
     #deltaadeIJ_none_24_vs_deltaadeIJ_none_17  up(0) down(0)
     #deltaadeIJ_one_24_vs_deltaadeIJ_one_17    up(0) down(8: gabT, H0N29_11475, H0N29_01015, H0N29_01030, ...)
     #deltaadeIJ_two_24_vs_deltaadeIJ_two_17    up(8) down(51)
  9. (NOT_PERFORMED) Volcano plots

     # ---- delta sbp TSB 2h vs WT TSB 2h ----
     res <- read.csv("Mitomycin_18h_vs_Untreated_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Mitomycin_18h_vs_Untreated_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Mitomycin_18h_vs_Untreated_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Mitomycin_18h_vs_Untreated_18h"))
     dev.off()
    
     # ---- delta sbp TSB 4h vs WT TSB 4h ----
     res <- read.csv("deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_4h_vs_WT_TSB_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_4h_vs_WT_TSB_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 4h versus WT TSB 4h"))
     dev.off()
    
     # ---- delta sbp TSB 18h vs WT TSB 18h ----
     res <- read.csv("deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_18h_vs_WT_TSB_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_18h_vs_WT_TSB_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 18h versus WT TSB 18h"))
     dev.off()
    
     # ---- delta sbp MH 2h vs WT MH 2h ----
     res <- read.csv("deltasbp_MH_2h_vs_WT_MH_2h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_2h_vs_WT_MH_2h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_2h_vs_WT_MH_2h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 2h versus WT MH 2h"))
     dev.off()
    
     # ---- delta sbp MH 4h vs WT MH 4h ----
     res <- read.csv("deltasbp_MH_4h_vs_WT_MH_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_4h_vs_WT_MH_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_4h_vs_WT_MH_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 4h versus WT MH 4h"))
     dev.off()
    
     # ---- delta sbp MH 18h vs WT MH 18h ----
     res <- read.csv("deltasbp_MH_18h_vs_WT_MH_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_18h_vs_WT_MH_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_18h_vs_WT_MH_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 18h versus WT MH 18h"))
     dev.off()
    
     #Annotate the Gene_Expression_xxx_vs_yyy.xlsx in the next steps (see below e.g. Gene_Expression_with_Annotations_Urine_vs_MHB.xlsx)

KEGG and GO annotations in non-model organisms

https://www.biobam.com/functional-analysis/

Blast2GO_workflow

10.1. Assign KEGG and GO Terms (see diagram above)

    Since your organism is non-model, standard R databases (org.Hs.eg.db, etc.) won’t work. You’ll need to manually retrieve KEGG and GO annotations.

    Option 1 (KEGG Terms): EggNog based on orthology and phylogenies

        EggNOG-mapper assigns both KEGG Orthology (KO) IDs and GO terms.

        Install EggNOG-mapper:

            mamba create -n eggnog_env python=3.8 eggnog-mapper -c conda-forge -c bioconda  #eggnog-mapper_2.1.12
            mamba activate eggnog_env

        Run annotation:

            #diamond makedb --in eggnog6.prots.faa -d eggnog_proteins.dmnd
            mkdir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            download_eggnog_data.py --dbname eggnog.db -y --data_dir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            #NOT_WORKING: emapper.py -i CP052959_gene.fasta -o eggnog_dmnd_out --cpu 60 -m diamond[hmmer,mmseqs] --dmnd_db /home/jhuang/REFs/eggnog_data/data/eggnog_proteins.dmnd
            #Download the protein sequences from Genbank
            mv ~/Downloads/sequence\(10\).txt CP052959_protein_.fasta
            python ~/Scripts/update_fasta_header.py CP052959_protein_.fasta CP052959_protein.fasta
            emapper.py -i CP052959_protein.fasta -o eggnog_out --cpu 20  #--resume
            #----> result annotations.tsv: Contains KEGG, GO, and other functional annotations.
            #---->  470.IX87_14445:
                * 470 likely refers to the organism or strain (e.g., Acinetobacter baumannii ATCC 19606 or another related strain).
                * IX87_14445 would refer to a specific gene or protein within that genome.

        Extract KEGG KO IDs from annotations.emapper.annotations.

    Option 2 (GO Terms from 'Blast2GO 5 Basic', saved in blast2go_annot.annot and blast2go_annot.annot2): Using Blast/Diamond + Blast2GO_GUI based on sequence alignment + GO mapping

    * jhuang@WS-2290C:~/DATA/Data_JuliaFuchs_RNAseq_2025$ ~/Tools/Blast2GO/Blast2GO_Launcher setting the workspace "mkdir ~/b2gWorkspace_JuliaFuchs_RNAseq_2025; cp /mnt/md1/DATA/Data_JuliaFuchs_RNAseq_2025/CP052959_protein.fasta ~/b2gWorkspace_JuliaFuchs_RNAseq_2025;"
    # ------ STEP_1: 100% Load Sequences (CP052959_protein): done ------
    * Button 'File' --> 'Load' --> 'Load Sequences' --> 'Load Fasta File (.fasta)' Choose a protein sequence file (e.g. CP052959_protein.fasta) (Tags: NONE, generated columns: Nr, SeqName) as input
    # ------ STEP_2: 100% QBlast (CP052959_protein): done with warnings [4-5 days]; similar to DAMIAN and the most time-consuming step is blastn/blastp ------
    * Button 'blast' at the NCBI (Parameters: blastp, nr, ...) (Tags: BLASTED, generated columns: Description, Length, #Hits, e-Value, sim mean),
            -- QBlast (CP052959_protein) Warning! --
            QBlast finished with warnings!
            Blasted Sequences: 2011
            Sequences without results: 99
            Check the Job log for details and try to submit again.
            Restarting QBlast may result in additional results, depending on the error type.
            "Blast (CP052959_protein) Done"
    # ------ STEP_3: 100% Mapping (CP052959_protein): done [3h56m10s] ------
    * Button 'mapping' (Tags: MAPPED, generated columns: #GO, GO IDs, GO Names)
            -- Mapping (CP052959_protein) Done --
            "Mapping finished - Please proceed now to annotation."
    # ------ STEP_4: 100% Annotation (CP052959_protein): done [7m56s] ------
    * Button 'annot' (Tags: ANNOTATED, generated columns: Enzyme Codes, Enzyme Names)
            * Used parameter 'Annotation CutOff': The Blast2GO Annotation Rule seeks to find the most specific GO annotations with a certain level of reliability. An annotation score is calculated for each candidate GO which is composed by the sequence similarity of the Blast Hit, the evidence code of the source GO and the position of the particular GO in the Gene Ontology hierarchy. This annotation score cutoff select the most specific GO term for a given GO branch which lies above this value.
            * Used parameter 'GO Weight' is a value which is added to Annotation Score of a more general/abstract Gene Ontology term for each of its more specific, original source GO terms. In this case, more general GO terms which summarise many original source terms (those ones directly associated to the Blast Hits) will have a higher Annotation Score.
            -- Annotation (CP052959_protein) Done --
            "Annotation finished."
    #(NOT_USED) or blast2go_cli_v1.5.1
            #https://help.biobam.com/space/BCD/2250407989/Installation
            #see ~/Scripts/blast2go_pipeline.sh

    # ------ STEP_5: 100% Export Annotations (CP052959_protein): done (for before_merging) ------
    + Button 'File' -> 'Export' -> 'Export Annotations' -> 'Export Annotations (.annot, custom, etc.)' as ~/b2gWorkspace_JuliaFuchs_RNAseq_2025/blast2go_annot.annot.

    + Option 3 (GO Terms from 'Blast2GO 5 Basic' using interpro): Interpro based protein families / domains --> Button interpro, Export Format XML (e.g. HJI06_00260.xml) to Folder "/home/jhuang/b2gWorkspace_JuliaFuchs_RNAseq_2025"
    # ------ STEP_6: 100% InterProSacn (CP052959_protein): done [1d6h41m51s] ------
    * Button 'interpro' (Tags: INTERPRO, generated columns: InterPro IDs, InterPro GO IDs, InterPro GO Names)
            -- InterProScan Finished, You can now merge the obtained GO Annotations. --
            "InterProScan (CP052959_protein) Done"
            "InterProScan Finished - You can now merge the obtained GO Annotations."
    + MERGE the results of InterPro GO IDs (Option 3) to GO IDs (Option 2) and generate final GO IDs
    # ------ STEP_7: 100% Merge InterProScan GOs to Annotation (CP052959_protein): done [1s] ------
    * Button 'interpro'/'Merge InterProScan GOs to Annotation' --> "Merge (add and validate) all GO terms retrieved via InterProScan to the already existing GO annotation."
            -- Merge InterProScan GOs to Annotation (CP052959_protein) Done --
            "Finished merging GO terms from InterPro with annotations."
            "Maybe you want to run ANNEX (Annotation Augmentation)."
    #* (NOT_USED) Button 'annot'/'ANNEX' --> "ANNEX finished. Maybe you want to do the next step: Enzyme Code Mapping."

    # ------ STEP_8: 100% Export Annotations (CP052959_protein): done (for after_merging) ------
    + Button 'File' -> 'Export' -> 'Export Annotations' -> 'Export Annotations (.annot, custom, etc.)' as ~/b2gWorkspace_JuliaFuchs_RNAseq_2025/blast2go_annot.annot2.

    #NOTE that annotations are different between before_merging and after_merging; after_merging has more annotation-items.
    #-- before merging (blast2go_annot.annot) --
    #H0N29_18790     GO:0004842      ankyrin repeat domain-containing protein
    #H0N29_18790     GO:0085020
    #None for HJI06_00005

    #-- after merging (blast2go_annot.annot2) -->
    #H0N29_18790     GO:0031436      ankyrin repeat domain-containing protein
    #H0N29_18790     GO:0070531
    #H0N29_18790     GO:0004842
    #H0N29_18790     GO:0005515
    #H0N29_18790     GO:0085020

    #HJI06_00005     GO:0005737      chromosomal replication initiator protein DnaA
    #HJI06_00005     GO:0005886
    #HJI06_00005     GO:0003688
    #HJI06_00005     GO:0005524
    #HJI06_00005     GO:0008289
    #HJI06_00005     GO:0016887
    #HJI06_00005     GO:0006270
    #HJI06_00005     GO:0006275
    #HJI06_00005     EC:3.6.1
    #HJI06_00005     EC:3.6
    #HJI06_00005     EC:3
    #HJI06_00005     EC:3.6.1.15

    Option 4 (NOT_USED): RFAM for non-colding RNA

    Option 5 (NOT_USED): PSORTb for subcellular localizations

    Option 6 (NOT_USED): KAAS (KEGG Automatic Annotation Server)

    * Go to KAAS
    * Upload your FASTA file.
    * Select an appropriate gene set.
    * Download the KO assignments.

10.2. Find the Closest KEGG Organism Code (NOT_USED)

    Since your species isn't directly in KEGG, use a closely related organism.

    * Check available KEGG organisms:

            library(clusterProfiler)
            library(KEGGREST)

            kegg_organisms <- keggList("organism")

            Pick the closest relative (e.g., zebrafish "dre" for fish, Arabidopsis "ath" for plants).

            # Search for Acinetobacter in the list
            grep("Acinetobacter", kegg_organisms, ignore.case = TRUE, value = TRUE)
            # Gammaproteobacteria
            #Extract KO IDs from the eggnog results for  "Acinetobacter baumannii strain ATCC 19606"

10.3. Find the Closest KEGG Organism for a Non-Model Species (NOT_USED)

    If your organism is not in KEGG, search for the closest relative:

            grep("fish", kegg_organisms, ignore.case = TRUE, value = TRUE)  # Example search

    For KEGG pathway enrichment in non-model species, use "ko" instead of a species code (the code has been intergrated in the point 4):

            kegg_enrich <- enrichKEGG(gene = gene_list, organism = "ko")  # "ko" = KEGG Orthology

10.4. Perform KEGG and GO Enrichment in R (under dir ~/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/results/star_salmon/degenes)

        #BiocManager::install("GO.db")
        #BiocManager::install("AnnotationDbi")

        # Load required libraries
        library(openxlsx)  # For Excel file handling
        library(dplyr)     # For data manipulation
        library(tidyr)
        library(stringr)
        library(clusterProfiler)  # For KEGG and GO enrichment analysis
        #library(org.Hs.eg.db)  # Replace with appropriate organism database
        library(GO.db)
        library(AnnotationDbi)

        setwd("~/DATA/Data_Tam_RNAseq_2025_subMIC_exposure_ATCC19606/results/star_salmon/degenes")
        # PREPARING go_terms and ec_terms: annot_* file: cut -f1-2 -d$'\t' blast2go_annot.annot2 > blast2go_annot.annot2_
        # PREPARING eggnog_out.emapper.annotations.txt from eggnog_out.emapper.annotations by removing ## lines at the beginning and END and renaming #query to query
        #(plot-numpy1) jhuang@WS-2290C:~/DATA/Data_JuliaFuchs_RNAseq_2025$ diff eggnog_out.emapper.annotations eggnog_out.emapper.annotations.txt
        #1,5c1
        #< ## Thu Jan 30 16:34:52 2025
        #< ## emapper-2.1.12
        #< ## /home/jhuang/mambaforge/envs/eggnog_env/bin/emapper.py -i CP059040_protein.fasta -o eggnog_out --cpu 60
        #< ##
        #< #query        seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway    KEGG_Module     KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #---
        #> query seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway   KEGG_Module      KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #3620,3622d3615
        #< ## 3614 queries scanned
        #< ## Total time (seconds): 8.176708459854126

        # Step 1: Load the blast2go annotation file with a check for missing columns
        annot_df <- read.table("/home/jhuang/b2gWorkspace_JuliaFuchs_RNAseq_2025/blast2go_annot.annot2_", header = FALSE, sep = "\t", stringsAsFactors = FALSE, fill = TRUE)

        # If the structure is inconsistent, we can make sure there are exactly 3 columns:
        colnames(annot_df) <- c("GeneID", "Term")
        # Step 2: Filter and aggregate GO and EC terms as before
        go_terms <- annot_df %>%
        filter(grepl("^GO:", Term)) %>%
        group_by(GeneID) %>%
        summarize(GOs = paste(Term, collapse = ","), .groups = "drop")
        ec_terms <- annot_df %>%
        filter(grepl("^EC:", Term)) %>%
        group_by(GeneID) %>%
        summarize(EC = paste(Term, collapse = ","), .groups = "drop")

        # Key Improvements:
        #    * Looped processing of all 6 input files to avoid redundancy.
        #    * Robust handling of empty KEGG and GO enrichment results to prevent contamination of results between iterations.
        #    * File-safe output: Each dataset creates a separate Excel workbook with enriched sheets only if data exists.
        #    * Error handling for GO term descriptions via tryCatch.
        #    * Improved clarity and modular structure for easier maintenance and future additions.

        #file_name = "deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv"

        # ---------------------- Generated DEG(Annotated)_KEGG_GO_* -----------------------
        suppressPackageStartupMessages({
          library(readr)
          library(dplyr)
          library(stringr)
          library(tidyr)
          library(openxlsx)
          library(clusterProfiler)
          library(AnnotationDbi)
          library(GO.db)
        })

        # ---- PARAMETERS ----
        PADJ_CUT <- 5e-2
        LFC_CUT  <- 2

        # Your emapper annotations (with columns: query, GOs, EC, KEGG_ko, KEGG_Pathway, KEGG_Module, ... )
        emapper_path <- "~/DATA/Data_JuliaFuchs_RNAseq_2025/eggnog_out.emapper.annotations.txt"

        # Input files (you can add/remove here)
        input_files <- c(
          "Mitomycin_18h_vs_Untreated_18h-all.csv",  #up 576, down 307 --> height 11000
          "Mitomycin_8h_vs_Untreated_8h-all.csv",    #up 580, down 201 --> height 11000
          "Mitomycin_4h_vs_Untreated_4h-all.csv",    #up 489, down 67  --> height 6400
          "Moxi_18h_vs_Untreated_18h-all.csv",       #up 472, down 317 --> height 10500
          "Moxi_8h_vs_Untreated_8h-all.csv",         #up 486, down 307 --> height 10500
          "Moxi_4h_vs_Untreated_4h-all.csv",         #up 349, down 118 --> height 6400
          "Untreated_18h_vs_Untreated_4h-all.csv",   #(up 262, down 51)
          "Untreated_18h_vs_Untreated_8h-all.csv",   #(up 124, down 26)
          "Untreated_8h_vs_Untreated_4h-all.csv",     #(up 90, down 18) --> in total 368 --> height 5000
          "Mitomycin_18h_vs_Mitomycin_4h-all.csv",   #(up 161, down 63)
          "Mitomycin_18h_vs_Mitomycin_8h-all.csv",   #(up 61, down 28)
          "Mitomycin_8h_vs_Mitomycin_4h-all.csv",     #(up 47, down 10) --> in total 279 --> height 3500
          "Moxi_18h_vs_Moxi_4h-all.csv",   #(up 141, down 29)
          "Moxi_18h_vs_Moxi_8h-all.csv",   #(up 15, down 3)
          "Moxi_8h_vs_Moxi_4h-all.csv"     #(up 67, down 2) --> in total 196 --> height 2600
        )

        # ---- HELPERS ----
        # Robust reader (CSV first, then TSV)
        read_table_any <- function(path) {
          tb <- tryCatch(readr::read_csv(path, show_col_types = FALSE),
                        error = function(e) tryCatch(readr::read_tsv(path, col_types = cols()),
                                                      error = function(e2) NULL))
          tb
        }

        # Return a nice Excel-safe base name
        xlsx_name_from_file <- function(path) {
          base <- tools::file_path_sans_ext(basename(path))
          paste0("DEG_KEGG_GO_", base, ".xlsx")
        }

        # KEGG expand helper: replace K-numbers with GeneIDs using mapping from the same result table
        expand_kegg_geneIDs <- function(kegg_res, mapping_tbl) {
          if (is.null(kegg_res) || nrow(as.data.frame(kegg_res)) == 0) return(data.frame())
          kdf <- as.data.frame(kegg_res)
          if (!"geneID" %in% names(kdf)) return(kdf)
          # mapping_tbl: columns KEGG_ko (possibly multiple separated by commas) and GeneID
          map_clean <- mapping_tbl %>%
            dplyr::select(KEGG_ko, GeneID) %>%
            filter(!is.na(KEGG_ko), KEGG_ko != "-") %>%
            mutate(KEGG_ko = str_remove_all(KEGG_ko, "ko:")) %>%
            tidyr::separate_rows(KEGG_ko, sep = ",") %>%
            distinct()

          if (!nrow(map_clean)) {
            return(kdf)
          }

          expanded <- kdf %>%
            tidyr::separate_rows(geneID, sep = "/") %>%
            dplyr::left_join(map_clean, by = c("geneID" = "KEGG_ko"), relationship = "many-to-many") %>%
            distinct() %>%
            dplyr::group_by(ID) %>%
            dplyr::summarise(across(everything(), ~ paste(unique(na.omit(.)), collapse = "/")), .groups = "drop")

          kdf %>%
            dplyr::select(-geneID) %>%
            dplyr::left_join(expanded %>% dplyr::select(ID, GeneID), by = "ID") %>%
            dplyr::rename(geneID = GeneID)
        }

        # ---- LOAD emapper annotations ----
        eggnog_data <- read.delim(emapper_path, header = TRUE, sep = "\t", quote = "", check.names = FALSE)
        # Ensure character columns for joins
        eggnog_data$query   <- as.character(eggnog_data$query)
        eggnog_data$GOs     <- as.character(eggnog_data$GOs)
        eggnog_data$EC      <- as.character(eggnog_data$EC)
        eggnog_data$KEGG_ko <- as.character(eggnog_data$KEGG_ko)

        # ---- MAIN LOOP ----
        for (f in input_files) {
          if (!file.exists(f)) { message("Missing: ", f); next }

          message("Processing: ", f)
          res <- read_table_any(f)
          if (is.null(res) || nrow(res) == 0) { message("Empty/unreadable: ", f); next }

          # Coerce expected columns if present
          if ("padj" %in% names(res))   res$padj <- suppressWarnings(as.numeric(res$padj))
          if ("log2FoldChange" %in% names(res)) res$log2FoldChange <- suppressWarnings(as.numeric(res$log2FoldChange))

          # Ensure GeneID & GeneName exist
          if (!"GeneID" %in% names(res)) {
            # Try to infer from a generic 'gene' column
            if ("gene" %in% names(res)) res$GeneID <- as.character(res$gene) else res$GeneID <- NA_character_
          }
          if (!"GeneName" %in% names(res)) res$GeneName <- NA_character_

          # Fill missing GeneName from GeneID (drop "gene-")
          res$GeneName <- ifelse(is.na(res$GeneName) | res$GeneName == "",
                                gsub("^gene-", "", as.character(res$GeneID)),
                                as.character(res$GeneName))

          # De-duplicate by GeneName, keep smallest padj
          if (!"padj" %in% names(res)) res$padj <- NA_real_
          res <- res %>%
            group_by(GeneName) %>%
            slice_min(padj, with_ties = FALSE) %>%
            ungroup() %>%
            as.data.frame()

          # Sort by padj asc, then log2FC desc
          if (!"log2FoldChange" %in% names(res)) res$log2FoldChange <- NA_real_
          res <- res[order(res$padj, -res$log2FoldChange), , drop = FALSE]

          # Join emapper (strip "gene-" from GeneID to match emapper 'query')
          res$GeneID_plain <- gsub("^gene-", "", res$GeneID)
          res_ann <- res %>%
            left_join(eggnog_data, by = c("GeneID_plain" = "query"))

          # --- Split by UP/DOWN using your volcano cutoffs ---
          up_regulated   <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange >  LFC_CUT)
          down_regulated <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange < -LFC_CUT)

          # --- KEGG enrichment (using K numbers in KEGG_ko) ---
          # Prepare KO lists (remove "ko:" if present)
          k_up <- up_regulated$KEGG_ko;   k_up <- k_up[!is.na(k_up)]
          k_dn <- down_regulated$KEGG_ko; k_dn <- k_dn[!is.na(k_dn)]
          k_up <- gsub("ko:", "", k_up);  k_dn <- gsub("ko:", "", k_dn)

          # BREAK_LINE

          kegg_up   <- tryCatch(enrichKEGG(gene = k_up, organism = "ko"), error = function(e) NULL)
          kegg_down <- tryCatch(enrichKEGG(gene = k_dn, organism = "ko"), error = function(e) NULL)

          # Convert KEGG K-numbers to your GeneIDs (using mapping from the same result set)
          kegg_up_df   <- expand_kegg_geneIDs(kegg_up,   up_regulated)
          kegg_down_df <- expand_kegg_geneIDs(kegg_down, down_regulated)

          # --- GO enrichment (custom TERM2GENE built from emapper GOs) ---
          # Background gene set = all genes in this comparison
          background_genes <- unique(res_ann$GeneID_plain)
          # TERM2GENE table (GO -> GeneID_plain)
          go_annotation <- res_ann %>%
            dplyr::select(GeneID_plain, GOs) %>%
            mutate(GOs = ifelse(is.na(GOs), "", GOs)) %>%
            tidyr::separate_rows(GOs, sep = ",") %>%
            filter(GOs != "") %>%
            dplyr::select(GOs, GeneID_plain) %>%
            distinct()

          # Gene lists for GO enricher
          go_list_up   <- unique(up_regulated$GeneID_plain)
          go_list_down <- unique(down_regulated$GeneID_plain)

          go_up <- tryCatch(
            enricher(gene = go_list_up, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )
          go_down <- tryCatch(
            enricher(gene = go_list_down, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )

          go_up_df   <- if (!is.null(go_up))   as.data.frame(go_up)   else data.frame()
          go_down_df <- if (!is.null(go_down)) as.data.frame(go_down) else data.frame()

          # Add GO term descriptions via GO.db (best-effort)
          add_go_term_desc <- function(df) {
            if (!nrow(df) || !"ID" %in% names(df)) return(df)
            df$Description <- sapply(df$ID, function(go_id) {
              term <- tryCatch(AnnotationDbi::select(GO.db, keys = go_id,
                                                    columns = "TERM", keytype = "GOID"),
                              error = function(e) NULL)
              if (!is.null(term) && nrow(term)) term$TERM[1] else NA_character_
            })
            df
          }
          go_up_df   <- add_go_term_desc(go_up_df)
          go_down_df <- add_go_term_desc(go_down_df)

          # ---- Write Excel workbook ----
          out_xlsx <- xlsx_name_from_file(f)
          wb <- createWorkbook()

          addWorksheet(wb, "Complete")
          writeData(wb, "Complete", res_ann)

          addWorksheet(wb, "Up_Regulated")
          writeData(wb, "Up_Regulated", up_regulated)

          addWorksheet(wb, "Down_Regulated")
          writeData(wb, "Down_Regulated", down_regulated)

          addWorksheet(wb, "KEGG_Enrichment_Up")
          writeData(wb, "KEGG_Enrichment_Up", kegg_up_df)

          addWorksheet(wb, "KEGG_Enrichment_Down")
          writeData(wb, "KEGG_Enrichment_Down", kegg_down_df)

          addWorksheet(wb, "GO_Enrichment_Up")
          writeData(wb, "GO_Enrichment_Up", go_up_df)

          addWorksheet(wb, "GO_Enrichment_Down")
          writeData(wb, "GO_Enrichment_Down", go_down_df)

          saveWorkbook(wb, out_xlsx, overwrite = TRUE)
          message("Saved: ", out_xlsx)
        }

10.5. (TODO) Draw the Venn diagram to compare the total DEGs across AUM, Urine, and MHB, irrespective of up- or down-regulation.

            library(openxlsx)

            # Function to read and clean gene ID files
            read_gene_ids <- function(file_path) {
            # Read the gene IDs from the file
            gene_ids <- readLines(file_path)

            # Remove any quotes and trim whitespaces
            gene_ids <- gsub('"', '', gene_ids)  # Remove quotes
            gene_ids <- trimws(gene_ids)  # Trim whitespaces

            # Remove empty entries or NAs
            gene_ids <- gene_ids[gene_ids != "" & !is.na(gene_ids)]

            return(gene_ids)
            }

            # Example list of LB files with both -up.id and -down.id for each condition
            lb_files_up <- c("LB.AB_vs_LB.WT19606-up.id", "LB.IJ_vs_LB.WT19606-up.id",
                            "LB.W1_vs_LB.WT19606-up.id", "LB.Y1_vs_LB.WT19606-up.id")
            lb_files_down <- c("LB.AB_vs_LB.WT19606-down.id", "LB.IJ_vs_LB.WT19606-down.id",
                            "LB.W1_vs_LB.WT19606-down.id", "LB.Y1_vs_LB.WT19606-down.id")

            # Combine both up and down files for each condition
            lb_files <- c(lb_files_up, lb_files_down)

            # Read gene IDs for each file in LB group
            #lb_degs <- setNames(lapply(lb_files, read_gene_ids), gsub("-(up|down).id", "", lb_files))
            lb_degs <- setNames(lapply(lb_files, read_gene_ids), make.unique(gsub("-(up|down).id", "", lb_files)))

            lb_degs_ <- list()
            combined_set <- c(lb_degs[["LB.AB_vs_LB.WT19606"]], lb_degs[["LB.AB_vs_LB.WT19606.1"]])
            #unique_combined_set <- unique(combined_set)
            lb_degs_$AB <- combined_set
            combined_set <- c(lb_degs[["LB.IJ_vs_LB.WT19606"]], lb_degs[["LB.IJ_vs_LB.WT19606.1"]])
            lb_degs_$IJ <- combined_set
            combined_set <- c(lb_degs[["LB.W1_vs_LB.WT19606"]], lb_degs[["LB.W1_vs_LB.WT19606.1"]])
            lb_degs_$W1 <- combined_set
            combined_set <- c(lb_degs[["LB.Y1_vs_LB.WT19606"]], lb_degs[["LB.Y1_vs_LB.WT19606.1"]])
            lb_degs_$Y1 <- combined_set

            # Example list of Mac files with both -up.id and -down.id for each condition
            mac_files_up <- c("Mac.AB_vs_Mac.WT19606-up.id", "Mac.IJ_vs_Mac.WT19606-up.id",
                            "Mac.W1_vs_Mac.WT19606-up.id", "Mac.Y1_vs_Mac.WT19606-up.id")
            mac_files_down <- c("Mac.AB_vs_Mac.WT19606-down.id", "Mac.IJ_vs_Mac.WT19606-down.id",
                            "Mac.W1_vs_Mac.WT19606-down.id", "Mac.Y1_vs_Mac.WT19606-down.id")

            # Combine both up and down files for each condition in Mac group
            mac_files <- c(mac_files_up, mac_files_down)

            # Read gene IDs for each file in Mac group
            mac_degs <- setNames(lapply(mac_files, read_gene_ids), make.unique(gsub("-(up|down).id", "", mac_files)))

            mac_degs_ <- list()
            combined_set <- c(mac_degs[["Mac.AB_vs_Mac.WT19606"]], mac_degs[["Mac.AB_vs_Mac.WT19606.1"]])
            mac_degs_$AB <- combined_set
            combined_set <- c(mac_degs[["Mac.IJ_vs_Mac.WT19606"]], mac_degs[["Mac.IJ_vs_Mac.WT19606.1"]])
            mac_degs_$IJ <- combined_set
            combined_set <- c(mac_degs[["Mac.W1_vs_Mac.WT19606"]], mac_degs[["Mac.W1_vs_Mac.WT19606.1"]])
            mac_degs_$W1 <- combined_set
            combined_set <- c(mac_degs[["Mac.Y1_vs_Mac.WT19606"]], mac_degs[["Mac.Y1_vs_Mac.WT19606.1"]])
            mac_degs_$Y1 <- combined_set

            # Function to clean sheet names to ensure no sheet name exceeds 31 characters
            truncate_sheet_name <- function(names_list) {
            sapply(names_list, function(name) {
            if (nchar(name) > 31) {
            return(substr(name, 1, 31))  # Truncate sheet name to 31 characters
            }
            return(name)
            })
            }

            # Assuming lb_degs_ is already a list of gene sets (LB.AB, LB.IJ, etc.)

            # Define intersections between different conditions for LB
            inter_lb_ab_ij <- intersect(lb_degs_$AB, lb_degs_$IJ)
            inter_lb_ab_w1 <- intersect(lb_degs_$AB, lb_degs_$W1)
            inter_lb_ab_y1 <- intersect(lb_degs_$AB, lb_degs_$Y1)
            inter_lb_ij_w1 <- intersect(lb_degs_$IJ, lb_degs_$W1)
            inter_lb_ij_y1 <- intersect(lb_degs_$IJ, lb_degs_$Y1)
            inter_lb_w1_y1 <- intersect(lb_degs_$W1, lb_degs_$Y1)

            # Define intersections between three conditions for LB
            inter_lb_ab_ij_w1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$W1))
            inter_lb_ab_ij_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$Y1))
            inter_lb_ab_w1_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$W1, lb_degs_$Y1))
            inter_lb_ij_w1_y1 <- Reduce(intersect, list(lb_degs_$IJ, lb_degs_$W1, lb_degs_$Y1))

            # Define intersection between all four conditions for LB
            inter_lb_ab_ij_w1_y1 <- Reduce(intersect, list(lb_degs_$AB, lb_degs_$IJ, lb_degs_$W1, lb_degs_$Y1))

            # Now remove the intersected genes from each original set for LB
            venn_list_lb <- list()

            # For LB.AB, remove genes that are also in other conditions
            venn_list_lb[["LB.AB_only"]] <- setdiff(lb_degs_$AB, union(inter_lb_ab_ij, union(inter_lb_ab_w1, inter_lb_ab_y1)))

            # For LB.IJ, remove genes that are also in other conditions
            venn_list_lb[["LB.IJ_only"]] <- setdiff(lb_degs_$IJ, union(inter_lb_ab_ij, union(inter_lb_ij_w1, inter_lb_ij_y1)))

            # For LB.W1, remove genes that are also in other conditions
            venn_list_lb[["LB.W1_only"]] <- setdiff(lb_degs_$W1, union(inter_lb_ab_w1, union(inter_lb_ij_w1, inter_lb_ab_w1_y1)))

            # For LB.Y1, remove genes that are also in other conditions
            venn_list_lb[["LB.Y1_only"]] <- setdiff(lb_degs_$Y1, union(inter_lb_ab_y1, union(inter_lb_ij_y1, inter_lb_ab_w1_y1)))

            # Add the intersections for LB (same as before)
            venn_list_lb[["LB.AB_AND_LB.IJ"]] <- inter_lb_ab_ij
            venn_list_lb[["LB.AB_AND_LB.W1"]] <- inter_lb_ab_w1
            venn_list_lb[["LB.AB_AND_LB.Y1"]] <- inter_lb_ab_y1
            venn_list_lb[["LB.IJ_AND_LB.W1"]] <- inter_lb_ij_w1
            venn_list_lb[["LB.IJ_AND_LB.Y1"]] <- inter_lb_ij_y1
            venn_list_lb[["LB.W1_AND_LB.Y1"]] <- inter_lb_w1_y1

            # Define intersections between three conditions for LB
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.W1"]] <- inter_lb_ab_ij_w1
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.Y1"]] <- inter_lb_ab_ij_y1
            venn_list_lb[["LB.AB_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ab_w1_y1
            venn_list_lb[["LB.IJ_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ij_w1_y1

            # Define intersection between all four conditions for LB
            venn_list_lb[["LB.AB_AND_LB.IJ_AND_LB.W1_AND_LB.Y1"]] <- inter_lb_ab_ij_w1_y1

            # Assuming mac_degs_ is already a list of gene sets (Mac.AB, Mac.IJ, etc.)

            # Define intersections between different conditions
            inter_mac_ab_ij <- intersect(mac_degs_$AB, mac_degs_$IJ)
            inter_mac_ab_w1 <- intersect(mac_degs_$AB, mac_degs_$W1)
            inter_mac_ab_y1 <- intersect(mac_degs_$AB, mac_degs_$Y1)
            inter_mac_ij_w1 <- intersect(mac_degs_$IJ, mac_degs_$W1)
            inter_mac_ij_y1 <- intersect(mac_degs_$IJ, mac_degs_$Y1)
            inter_mac_w1_y1 <- intersect(mac_degs_$W1, mac_degs_$Y1)

            # Define intersections between three conditions
            inter_mac_ab_ij_w1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$W1))
            inter_mac_ab_ij_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$Y1))
            inter_mac_ab_w1_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$W1, mac_degs_$Y1))
            inter_mac_ij_w1_y1 <- Reduce(intersect, list(mac_degs_$IJ, mac_degs_$W1, mac_degs_$Y1))

            # Define intersection between all four conditions
            inter_mac_ab_ij_w1_y1 <- Reduce(intersect, list(mac_degs_$AB, mac_degs_$IJ, mac_degs_$W1, mac_degs_$Y1))

            # Now remove the intersected genes from each original set
            venn_list_mac <- list()

            # For Mac.AB, remove genes that are also in other conditions
            venn_list_mac[["Mac.AB_only"]] <- setdiff(mac_degs_$AB, union(inter_mac_ab_ij, union(inter_mac_ab_w1, inter_mac_ab_y1)))

            # For Mac.IJ, remove genes that are also in other conditions
            venn_list_mac[["Mac.IJ_only"]] <- setdiff(mac_degs_$IJ, union(inter_mac_ab_ij, union(inter_mac_ij_w1, inter_mac_ij_y1)))

            # For Mac.W1, remove genes that are also in other conditions
            venn_list_mac[["Mac.W1_only"]] <- setdiff(mac_degs_$W1, union(inter_mac_ab_w1, union(inter_mac_ij_w1, inter_mac_ab_w1_y1)))

            # For Mac.Y1, remove genes that are also in other conditions
            venn_list_mac[["Mac.Y1_only"]] <- setdiff(mac_degs_$Y1, union(inter_mac_ab_y1, union(inter_mac_ij_y1, inter_mac_ab_w1_y1)))

            # Add the intersections (same as before)
            venn_list_mac[["Mac.AB_AND_Mac.IJ"]] <- inter_mac_ab_ij
            venn_list_mac[["Mac.AB_AND_Mac.W1"]] <- inter_mac_ab_w1
            venn_list_mac[["Mac.AB_AND_Mac.Y1"]] <- inter_mac_ab_y1
            venn_list_mac[["Mac.IJ_AND_Mac.W1"]] <- inter_mac_ij_w1
            venn_list_mac[["Mac.IJ_AND_Mac.Y1"]] <- inter_mac_ij_y1
            venn_list_mac[["Mac.W1_AND_Mac.Y1"]] <- inter_mac_w1_y1

            # Define intersections between three conditions
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.W1"]] <- inter_mac_ab_ij_w1
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.Y1"]] <- inter_mac_ab_ij_y1
            venn_list_mac[["Mac.AB_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ab_w1_y1
            venn_list_mac[["Mac.IJ_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ij_w1_y1

            # Define intersection between all four conditions
            venn_list_mac[["Mac.AB_AND_Mac.IJ_AND_Mac.W1_AND_Mac.Y1"]] <- inter_mac_ab_ij_w1_y1

            # Save the gene IDs to Excel for further inspection (optional)
            write.xlsx(lb_degs, file = "LB_DEGs.xlsx")
            write.xlsx(mac_degs, file = "Mac_DEGs.xlsx")

            # Clean sheet names and write the Venn intersection sets for LB and Mac groups into Excel files
            write.xlsx(venn_list_lb, file = "Venn_LB_Genes_Intersect.xlsx", sheetName = truncate_sheet_name(names(venn_list_lb)), rowNames = FALSE)
            write.xlsx(venn_list_mac, file = "Venn_Mac_Genes_Intersect.xlsx", sheetName = truncate_sheet_name(names(venn_list_mac)), rowNames = FALSE)

            # Venn Diagram for LB group
            venn1 <- ggvenn(lb_degs_,
                            fill_color = c("skyblue", "tomato", "gold", "orchid"),
                            stroke_size = 0.4,
                            set_name_size = 5)
            ggsave("Venn_LB_Genes.png", plot = venn1, width = 7, height = 7, dpi = 300)

            # Venn Diagram for Mac group
            venn2 <- ggvenn(mac_degs_,
                            fill_color = c("lightgreen", "slateblue", "plum", "orange"),
                            stroke_size = 0.4,
                            set_name_size = 5)
            ggsave("Venn_Mac_Genes.png", plot = venn2, width = 7, height = 7, dpi = 300)

            cat("✅ All Venn intersection sets exported to Excel successfully.\n")
  1. Clustering the genes and draw heatmap

    #http://xgenes.com/article/article-content/150/draw-venn-diagrams-using-matplotlib/
    #http://xgenes.com/article/article-content/276/go-terms-for-s-epidermidis/
    # save the Up-regulated and Down-regulated genes into -up.id and -down.id
    
    for i in Mitomycin_18h_vs_Untreated_18h Mitomycin_8h_vs_Untreated_8h Mitomycin_4h_vs_Untreated_4h Moxi_18h_vs_Untreated_18h Moxi_8h_vs_Untreated_8h Moxi_4h_vs_Untreated_4h Mitomycin_18h_vs_Mitomycin_4h Mitomycin_18h_vs_Mitomycin_8h Mitomycin_8h_vs_Mitomycin_4h  Moxi_18h_vs_Moxi_4h Moxi_18h_vs_Moxi_8h Moxi_8h_vs_Moxi_4h  Untreated_18h_vs_Untreated_4h Untreated_18h_vs_Untreated_8h Untreated_8h_vs_Untreated_4h; do
      echo "cut -d',' -f1-1 ${i}-up.txt > ${i}-up.id";
      echo "cut -d',' -f1-1 ${i}-down.txt > ${i}-down.id";
    done
    
    #The row’s description column says “TsaE,” but the preferred_name is ydiB (shikimate/quinate dehydrogenase).
    #Length = 301 aa — that fits YdiB much better. TsaE (YjeE) is a small P-loop ATPase, typically ~150–170 aa, not ~300 aa.
    #The COG/orthology hit and the very strong e-value also point to a canonical enzyme rather than the tiny TsaE ATPase.
    #What likely happened
    #The “GeneName” (tsaE) was inherited from a prior/automated annotation.
    #Orthology mapping (preferred_name) recognizes the protein as YdiB; the free-text product line didn’t update, leaving a label clash.
    #What to do
    #Treat this locus as ydiB (shikimate dehydrogenase; aka AroE-II), not TsaE.
    #If you want to be thorough, BLAST the sequence and/or run InterPro/eggNOG: you should see SDR/oxidoreductase motifs for YdiB, not the P-loop NTPase (Walker A) you’d expect for TsaE.
    #Check your genome for the true t6A genes (tsaB/tsaD/tsaE/tsaC); the real tsaE should be a much smaller ORF.
    # -- Replace GeneName with Preferred_name when Preferred_name is non-empty and not '-' (first sheet). --
    for i in Mitomycin_18h_vs_Untreated_18h Mitomycin_8h_vs_Untreated_8h Mitomycin_4h_vs_Untreated_4h Moxi_18h_vs_Untreated_18h Moxi_8h_vs_Untreated_8h Moxi_4h_vs_Untreated_4h Mitomycin_18h_vs_Mitomycin_4h Mitomycin_18h_vs_Mitomycin_8h Mitomycin_8h_vs_Mitomycin_4h  Moxi_18h_vs_Moxi_4h Moxi_18h_vs_Moxi_8h Moxi_8h_vs_Moxi_4h  Untreated_18h_vs_Untreated_4h Untreated_18h_vs_Untreated_8h Untreated_8h_vs_Untreated_4h; do
      python ~/Scripts/replace_with_preferred_name.py DEG_KEGG_GO_${i}-all.xlsx -o ${i}-all_annotated.csv
    done
    
    # ------------------ Heatmap generation for two samples ----------------------
    
    ## ------------------------------------------------------------
    ## DEGs heatmap (dynamic GOI + dynamic column tags)
    ## Example contrast: deltasbp_TSB_2h_vs_WT_TSB_2h
    ## Assumes 'rld' (or 'vsd') is in the environment (DESeq2 transform)
    ## ------------------------------------------------------------
    
    #RUN rld generation code (see the first part of the file)
    setwd("degenes")
    ## 0) Config ---------------------------------------------------
    contrast <- "Mitomycin_18h_vs_Untreated_18h"  #up 576, down 307 --> height 11000
    contrast <- "Mitomycin_8h_vs_Untreated_8h"    #up 580, down 201 --> height 11000
    contrast <- "Mitomycin_4h_vs_Untreated_4h"    #up 489, down 67  --> height 6500
    contrast <- "Moxi_18h_vs_Untreated_18h"       #up 472, down 317 --> height 10500
    contrast <- "Moxi_8h_vs_Untreated_8h"         #up 486, down 307 --> height 10500
    contrast <- "Moxi_4h_vs_Untreated_4h"         #up 349, down 118 --> height 6500
    
    ## 1) Packages -------------------------------------------------
    need <- c("gplots")
    to_install <- setdiff(need, rownames(installed.packages()))
    if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org")
    suppressPackageStartupMessages(library(gplots))
    
    ## 2) Helpers --------------------------------------------------
    # Read IDs from a file that may be:
    #  - one column with or without header "Gene_Id"
    #  - may contain quotes
    read_ids_from_file <- function(path) {
      #path <- up_file
      if (!file.exists(path)) stop("File not found: ", path)
      df <- tryCatch(
        read.table(path, header = TRUE, stringsAsFactors = FALSE, quote = "\"'", comment.char = ""),
        error = function(e) NULL
      )
      if (!is.null(df) && ncol(df) >= 1) {
        if ("Gene_Id" %in% names(df)) {
          ids <- df[["Gene_Id"]]
        } else if (ncol(df) == 1L) {
          ids <- df[[1]]
        } else {
          first_nonempty <- which(colSums(df != "", na.rm = TRUE) > 0)[1]
          if (is.na(first_nonempty)) stop("No usable IDs in: ", path)
          ids <- df[[first_nonempty]]
        }
      } else {
        df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "")
        if (ncol(df2) < 1L) stop("No usable IDs in: ", path)
        ids <- df2[[1]]
      }
      ids <- trimws(gsub('"', "", ids))
      ids[nzchar(ids)]
    }
    
    #BREAK_LINE
    
    # From "A_vs_B" get c("A","B")
    split_contrast_groups <- function(x) {
      parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]]
      if (length(parts) != 2L) stop("Contrast must be in the form 'GroupA_vs_GroupB'")
      parts
    }
    
    # Match whole tags at boundaries or underscores
    match_tags <- function(nms, tags) {
      pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)")
      grepl(pat, nms, perl = TRUE)
    }
    
    ## 3) Expression matrix (DESeq2 rlog/vst) ----------------------
    # Use rld if present; otherwise try vsd
    if (exists("rld")) {
      expr_all <- assay(rld)
    } else if (exists("vsd")) {
      expr_all <- assay(vsd)
    } else {
      stop("Neither 'rld' nor 'vsd' object is available in the environment.")
    }
    RNASeq.NoCellLine <- as.matrix(expr_all)
    #colnames(RNASeq.NoCellLine) <- c("WT_none_17_r1", "WT_none_17_r2", "WT_none_17_r3", "WT_none_24_r1", "WT_none_24_r2", "WT_none_24_r3", "deltaadeIJ_none_17_r1", "deltaadeIJ_none_17_r2", "deltaadeIJ_none_17_r3", "deltaadeIJ_none_24_r1", "deltaadeIJ_none_24_r2", "deltaadeIJ_none_24_r3", "WT_one_17_r1", "WT_one_17_r2", "WT_one_17_r3", "WT_one_24_r1", "WT_one_24_r2", "WT_one_24_r3", "deltaadeIJ_one_17_r1", "deltaadeIJ_one_17_r2", "deltaadeIJ_one_17_r3", "deltaadeIJ_one_24_r1", "deltaadeIJ_one_24_r2", "deltaadeIJ_one_24_r3", "WT_two_17_r1",      "WT_two_17_r2", "WT_two_17_r3", "WT_two_24_r1", "WT_two_24_r2", "WT_two_24_r3", "deltaadeIJ_two_17_r1", "deltaadeIJ_two_17_r2", "deltaadeIJ_two_17_r3", "deltaadeIJ_two_24_r1", "deltaadeIJ_two_24_r2", "deltaadeIJ_two_24_r3")
    
    # -- RUN the code with the new contract from HERE after first run --
    
    ## 4) Build GOI from the two .id files (Note that if empty not run!)-------------------------
    up_file   <- paste0(contrast, "-up.id")
    down_file <- paste0(contrast, "-down.id")
    GOI_up   <- read_ids_from_file(up_file)
    GOI_down <- read_ids_from_file(down_file)
    GOI <- unique(c(GOI_up, GOI_down))
    if (length(GOI) == 0) stop("No gene IDs found in up/down .id files.")
    
    # GOI are already 'gene-*' in your data — use them directly for matching
    present <- intersect(rownames(RNASeq.NoCellLine), GOI)
    if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.")
    # Optional: report truly missing IDs (on the same 'gene-*' format)
    missing <- setdiff(GOI, present)
    if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.")
    
    ## 5) Keep ONLY columns for the two groups in the contrast -----
    groups <- split_contrast_groups(contrast)  # e.g., c("deltasbp_TSB_2h", "WT_TSB_2h")
    keep_cols <- match_tags(colnames(RNASeq.NoCellLine), groups)
    if (!any(keep_cols)) {
      stop("No columns matched the contrast groups: ", paste(groups, collapse = " and "),
          ". Check your column names or implement colData-based filtering.")
    }
    cols_idx <- which(keep_cols)
    sub_colnames <- colnames(RNASeq.NoCellLine)[cols_idx]
    
    # Put the second group first (e.g., WT first in 'deltasbp..._vs_WT...')
    ord <- order(!grepl(paste0("(^|_)", groups[2], "(_|$)"), sub_colnames, perl = TRUE))
    
    # Subset safely
    expr_sub <- RNASeq.NoCellLine[present, cols_idx, drop = FALSE][, ord, drop = FALSE]
    
    ## 6) Remove constant/NA rows ----------------------------------
    row_ok <- apply(expr_sub, 1, function(x) is.finite(sum(x)) && var(x, na.rm = TRUE) > 0)
    if (any(!row_ok)) message("Removing ", sum(!row_ok), " constant/NA rows.")
    datamat <- expr_sub[row_ok, , drop = FALSE]
    
    # Save the filtered matrix used for the heatmap (optional)
    out_mat <- paste0("DEGs_heatmap_expression_data_", contrast, ".txt")
    write.csv(as.data.frame(datamat), file = out_mat, quote = FALSE)
    
    #BREAK_LINE
    
    ## 7) Pretty labels (display only) ---------------------------
    # Start from rownames(datamat) (assumed to be GeneID)
    labRow_pretty <- rownames(datamat)
    # ---- Replace GeneID with GeneName from "
    -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty ‘ΔadeIJ’ and nicer spacing labCol_pretty <- colnames(datamat) labCol_pretty <- gsub("^deltasbp", "\u0394sbp", labCol_pretty) labCol_pretty “WT TSB 2h r1” # If you prefer to drop replicate suffixes, uncomment: # labCol_pretty <- gsub(" r\\d+$", "", labCol_pretty) ## 8) Clustering ———————————————– # Row clustering with Pearson distance hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") #row_cor <- suppressWarnings(cor(t(datamat), method = "pearson", use = "pairwise.complete.obs")) #row_cor[!is.finite(row_cor)] <- 0 #hr <- hclust(as.dist(1 – row_cor), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.1) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] #BREAK_LINE labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty <- sub("^rna-", "", labRow_pretty) png(paste0("DEGs_heatmap_", contrast, ".png"), width=800, height=600) heatmap.2(datamat, Rowv = as.dendrogram(hr), col = bluered(75), scale = "row", RowSideColors = mycol, trace = "none", margin = c(10, 20), # bottom, left sepwidth = c(0, 0), dendrogram = 'row', Colv = 'false', density.info = 'none', labRow = labRow_pretty, # row labels WITHOUT "gene-" labCol = labCol_pretty, # col labels with Δsbp + spaces cexRow = 2.5, cexCol = 2.5, srtCol = 15, lhei = c(0.6, 4), # enlarge the first number when reduce the plot size to avoid the error 'Error in plot.new() : figure margins too large' lwid = c(0.8, 4)) # enlarge the first number when reduce the plot size to avoid the error 'Error in plot.new() : figure margins too large' dev.off() # DEBUG for some items starting with "gene-" labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty <- sub("^rna-", "", labRow_pretty) png(paste0("DEGs_heatmap_", contrast, ".png"), width = 800, height = 6500) heatmap.2( datamat, Rowv = as.dendrogram(hr), Colv = FALSE, dendrogram = "row", col = bluered(75), scale = "row", trace = "none", density.info = "none", RowSideColors = mycol, margins = c(10, 15), # c(bottom, left) sepwidth = c(0, 0), labRow = labRow_pretty, labCol = labCol_pretty, cexRow = 1.4, # ↓ smaller column label font (was 1.3) cexCol = 1.8, srtCol = 15, lhei = c(0.01, 4), lwid = c(0.5, 4), key = FALSE # safer; add manual z-score key if you want (see note below) ) dev.off() # —————— Heatmap generation for three samples ———————- ## ============================================================ ## Three-condition DEGs heatmap from multiple pairwise contrasts ## Example contrasts: ## "WT_MH_4h_vs_WT_MH_2h", ## "WT_MH_18h_vs_WT_MH_2h", ## "WT_MH_18h_vs_WT_MH_4h" ## Output shows the union of DEGs across all contrasts and ## only the columns (samples) for the 3 conditions. ## ============================================================ ## ——– 0) User inputs ———————————— contrasts in total 368 –> height 5000 ) contrasts in total 279 –> height 3500 ) contrasts in total 196 –> height 2600 ) ## Optionally force a condition display order (defaults to order of first appearance) cond_order <- c("Untreated_4h","Untreated_8h","Untreated_18h") cond_order <- c("Mitomycin_4h","Mitomycin_8h","Mitomycin_18h") cond_order <- c("Moxi_4h","Moxi_8h","Moxi_18h") #cond_order <- NULL ## ——– 1) Packages ————————————— need <- c("gplots") to_install <- setdiff(need, rownames(installed.packages())) if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org") suppressPackageStartupMessages(library(gplots)) ## ——– 2) Helpers —————————————- read_ids_from_file <- function(path) { if (!file.exists(path)) stop("File not found: ", path) df = 1) { ids <- if ("Gene_Id" %in% names(df)) df[["Gene_Id"]] else df[[1]] } else { df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "") ids <- df2[[1]] } ids <- trimws(gsub('"', "", ids)) ids[nzchar(ids)] } # From "A_vs_B" return c("A","B") split_contrast_groups <- function(x) { parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]] if (length(parts) != 2L) stop("Contrast must be 'GroupA_vs_GroupB': ", x) parts } # Grep whole tag between start/end or underscores match_tags <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # Pretty labels for columns (optional tweaks) prettify_col_labels <- function(x) { x <- gsub("^deltasbp", "\u0394sbp", x) # example from your earlier case x <- gsub("_", " ", x) x } # BREAK_LINE # — RUN the code with the new contract from HERE after first run — ## ——– 3) Build GOI (union across contrasts) ————- up_files <- paste0(contrasts, "-up.id") down_files <- paste0(contrasts, "-down.id") GOI <- unique(unlist(c( lapply(up_files, read_ids_from_file), lapply(down_files, read_ids_from_file) ))) if (!length(GOI)) stop("No gene IDs found in any up/down .id files for the given contrasts.") ## ——– 4) Expression matrix (rld or vsd) —————– if (exists("rld")) { expr_all <- assay(rld) } else if (exists("vsd")) { expr_all <- assay(vsd) } else { stop("Neither 'rld' nor 'vsd' object is available in the environment.") } expr_all <- as.matrix(expr_all) present <- intersect(rownames(expr_all), GOI) if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.") missing <- setdiff(GOI, present) if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.") ## ——– 5) Infer the THREE condition tags —————– pair_groups <- lapply(contrasts, split_contrast_groups) # list of c(A,B) cond_tags <- unique(unlist(pair_groups)) if (length(cond_tags) != 3L) { stop("Expected exactly three unique condition tags across the contrasts, got: ", paste(cond_tags, collapse = ", ")) } # If user provided an explicit order, use it; else keep first-appearance order if (!is.null(cond_order)) { if (!setequal(cond_order, cond_tags)) stop("cond_order must contain exactly these tags: ", paste(cond_tags, collapse = ", ")) cond_tags <- cond_order } #BREAK_LINE ## ——– 6) Subset columns to those 3 conditions ———– # helper: does a name contain any of the tags? match_any_tag <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # helper: return the specific tag that a single name matches detect_tag <- function(nm, tags) { hits <- vapply(tags, function(t) grepl(paste0("(^|_)", t, "(_|$)"), nm, perl = TRUE), logical(1)) if (!any(hits)) NA_character_ else tags[which(hits)[1]] } keep_cols <- match_any_tag(colnames(expr_all), cond_tags) if (!any(keep_cols)) { stop("No columns matched any of the three condition tags: ", paste(cond_tags, collapse = ", ")) } sub_idx <- which(keep_cols) sub_colnames <- colnames(expr_all)[sub_idx] # find the tag for each kept column (this is the part that was wrong before) cond_for_col <- vapply(sub_colnames, detect_tag, character(1), tags = cond_tags) # rank columns by your desired condition order, then by name within each condition cond_rank <- match(cond_for_col, cond_tags) ord <- order(cond_rank, sub_colnames) expr_sub <- expr_all[present, sub_idx, drop = FALSE][, ord, drop = FALSE] ## ——– 7) Remove constant/NA rows ———————— row_ok 0) if (any(!row_ok)) message(“Removing “, sum(!row_ok), ” constant/NA rows.”) datamat <- expr_sub[row_ok, , drop = FALSE] ## ——– 8) Labels —————————————- labRow_pretty <- rownames(datamat) # —- Replace GeneID with GeneName from " -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty <- make.unique(repl, sep = "_") } else { warning("Could not find GeneID/GeneName columns in ", all_path) } } else { warning("File not found: ", all_path) } labCol_pretty <- prettify_col_labels(colnames(datamat)) #BREAK_LINE ## ——– 9) Clustering (rows) —————————— hr <- hclust(as.dist(1 – cor(t(datamat), method = "pearson")), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.3) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] ## ——– 10) Save the matrix used ————————– out_tag <- paste(cond_tags, collapse = "_") write.csv(as.data.frame(datamat), file = paste0("DEGs_heatmap_expression_data_", out_tag, ".txt"), quote = FALSE) ## ——– 11) Plot heatmap ———————————- labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty ids #add Gene_Id in the first line, delete the “” #Note that using GeneID as index, rather than GeneName, since .txt contains only GeneID. GOI <- read.csv("ids")$Gene_Id RNASeq.NoCellLine <- assay(rld) #install.packages("gplots") library("gplots") #clustering methods: "ward.D", "ward.D2", "single", "complete", "average" (= UPGMA), "mcquitty" (= WPGMA), "median" (= WPGMC) or "centroid" (= UPGMC). pearson or spearman datamat = RNASeq.NoCellLine[GOI, ] #datamat = RNASeq.NoCellLine write.csv(as.data.frame(datamat), file ="DEGs_heatmap_expression_data.txt") constant_rows <- apply(datamat, 1, function(row) var(row) == 0) if(any(constant_rows)) { cat("Removing", sum(constant_rows), "constant rows.\n") datamat <- datamat[!constant_rows, ] } hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") hc <- hclust(as.dist(1-cor(datamat, method="spearman")), method="complete") mycl = cutree(hr, h=max(hr$height)/1.1) mycol = c("YELLOW", "BLUE", "ORANGE", "MAGENTA", "CYAN", "RED", "GREEN", "MAROON", "LIGHTBLUE", "PINK", "MAGENTA", "LIGHTCYAN", "LIGHTRED", "LIGHTGREEN"); mycol = mycol[as.vector(mycl)] png("DEGs_heatmap_deltasbp_TSB_2h_vs_WT_TSB_2h.png", width=1200, height=2000) heatmap.2(datamat, Rowv = as.dendrogram(hr), col = bluered(75), scale = "row", RowSideColors = mycol, trace = "none", margin = c(10, 15), # bottom, left sepwidth = c(0, 0), dendrogram = 'row', Colv = 'false', density.info = 'none', labRow = rownames(datamat), cexRow = 1.5, cexCol = 1.5, srtCol = 35, lhei = c(0.2, 4), # reduce top space (was 1 or more) lwid = c(0.4, 4)) # reduce left space (was 1 or more) dev.off() # ————– Cluster members —————- write.csv(names(subset(mycl, mycl == '1')),file='cluster1_YELLOW.txt') write.csv(names(subset(mycl, mycl == '2')),file='cluster2_DARKBLUE.txt') write.csv(names(subset(mycl, mycl == '3')),file='cluster3_DARKORANGE.txt') write.csv(names(subset(mycl, mycl == '4')),file='cluster4_DARKMAGENTA.txt') write.csv(names(subset(mycl, mycl == '5')),file='cluster5_DARKCYAN.txt') #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.txt -d',' -o DEGs_heatmap_cluster_members.xls #~/Tools/csv2xls-0.4/csv_to_xls.py DEGs_heatmap_expression_data.txt -d',' -o DEGs_heatmap_expression_data.xls; #### (NOT_WORKING) cluster members (adding annotations, note that it does not work for the bacteria, since it is not model-speices and we cannot use mart=ensembl) ##### subset_1<-names(subset(mycl, mycl == '1')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_1, ]) #2575 subset_2<-names(subset(mycl, mycl == '2')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_2, ]) #1855 subset_3<-names(subset(mycl, mycl == '3')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_3, ]) #217 subset_4<-names(subset(mycl, mycl == '4')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_4, ]) # subset_5<-names(subset(mycl, mycl == '5')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_5, ]) # # Initialize an empty data frame for the annotated data annotated_data <- data.frame() # Determine total number of genes total_genes <- length(rownames(data)) # Loop through each gene to annotate for (i in 1:total_genes) { gene <- rownames(data)[i] result 1) { result <- result[1, ] } # Check if the result is empty if (nrow(result) == 0) { result <- data.frame(ensembl_gene_id = gene, external_gene_name = NA, gene_biotype = NA, entrezgene_id = NA, chromosome_name = NA, start_position = NA, end_position = NA, strand = NA, description = NA) } # Transpose expression values expression_values <- t(data.frame(t(data[gene, ]))) colnames(expression_values) <- colnames(data) # Combine gene information and expression data combined_result <- cbind(result, expression_values) # Append to the final dataframe annotated_data <- rbind(annotated_data, combined_result) # Print progress every 100 genes if (i %% 100 == 0) { cat(sprintf("Processed gene %d out of %d\n", i, total_genes)) } } # Save the annotated data to a new CSV file write.csv(annotated_data, "cluster1_YELLOW.csv", row.names=FALSE) write.csv(annotated_data, "cluster2_DARKBLUE.csv", row.names=FALSE) write.csv(annotated_data, "cluster3_DARKORANGE.csv", row.names=FALSE) write.csv(annotated_data, "cluster4_DARKMAGENTA.csv", row.names=FALSE) write.csv(annotated_data, "cluster5_DARKCYAN.csv", row.names=FALSE) #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.csv -d',' -o DEGs_heatmap_clusters.xls

Processing Data_Michelle_RNAseq_2025 v3

  1. Targets

     The experiment we did so far:
     I have two strains:
     1. 1457 wildtype
     2. 1457Δsbp (sbp knock out strain)
    
     I have grown these two strains in two media for 2h (early biofilm phase, primary attachment), 4h (biofilm accumulation phase), 18h (mature biofilm phase) respectively
     1. medium TSB -> nutrient-rich medium: differences in biofilm formation and growth visible (sbp knockout shows less biofilm formation and a growth deficit)
     2. medium MH -> nutrient-poor medium: differences between wild type more obvious (sbp knockout shows stronger growth deficit)
    
     Our idea/hypothesis of what we hope to achieve with the RNA-Seq:
     Since we already see differences in growth and biofilm formation and also differences in the proteome (through cooperation with mass spectrometry), we also expect differences in the transcription of the genes in the RNA-Seq. Could you analyze the RNA-Seq data for me and compare the strains at the different time points? But maybe also compare the different time points of one strain with each other?
     The following would be interesting for me:
     - PCA plot (sample comparison)
     - Heatmaps (wild type vs. sbp knockout)
     - Volcano plots (significant genes)
     - Gene Ontology (GO) analyses
  2. Download the raw data

     Mail von BGI (RNA-SEQ Institute):
     The data from project F25A430000603 are uploaded to AWS.
     Please download the data as below:
     URL:https://s3.console.aws.amazon.com/s3/buckets/stakimxp-598731762349?region=eu-central-1&tab=objects
     Project:F25A430000603-01-STAkimxP
     Alias ID:598731762349
     S3 Bucket:stakimxp-598731762349
     Account:stakimxp
     Password:qR0'A7[o9Ql|
     Region:eu-central-1
     Aws_access_key_id:AKIAYWZZRVKW72S4SCPG
     Aws_secret_access_key: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
    
     aws s3 cp s3://stakimxp-598731762349/ ./ --recursive
    
     cp -r raw_data/ /media/jhuang/Smarty/Data_Michelle_RNAseq_2025_raw_data_DEL
     rsync -avzP /local/dir/ user@remote:/remote/dir/
     rsync -avzP raw_data jhuang@10.169.63.113:/home/jhuang/DATA/Data_Michelle_RNAseq_2025_raw_data_DEL_AFTER_UPLOAD_GEO
  3. Prepare raw data

     mkdir raw_data; cd raw_data
    
     #Δsbp->deltasbp
     #1457.1_2h_MH,WT,MH,2h,1
     ln -s ../F25A430000603-01_STAkimxP/1457.1_2h_MH/1457.1_2h_MH_1.fq.gz WT_MH_2h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.1_2h_MH/1457.1_2h_MH_2.fq.gz WT_MH_2h_1_R2.fastq.gz
     #1457.2_2h_
     ln -s ../F25A430000603-01_STAkimxP/1457.2_2h_MH/1457.2_2h_MH_1.fq.gz WT_MH_2h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.2_2h_MH/1457.2_2h_MH_2.fq.gz WT_MH_2h_2_R2.fastq.gz
     #1457.3_2h_
     ln -s ../F25A430000603-01_STAkimxP/1457.3_2h_MH/1457.3_2h_MH_1.fq.gz WT_MH_2h_3_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.3_2h_MH/1457.3_2h_MH_2.fq.gz WT_MH_2h_3_R2.fastq.gz
     #1457.1_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457.1_4h_MH/1457.1_4h_MH_1.fq.gz WT_MH_4h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.1_4h_MH/1457.1_4h_MH_2.fq.gz WT_MH_4h_1_R2.fastq.gz
     #1457.2_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457.2_4h_MH/1457.2_4h_MH_1.fq.gz WT_MH_4h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.2_4h_MH/1457.2_4h_MH_2.fq.gz WT_MH_4h_2_R2.fastq.gz
     #1457.3_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457.3_4h_MH/1457.3_4h_MH_1.fq.gz WT_MH_4h_3_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.3_4h_MH/1457.3_4h_MH_2.fq.gz WT_MH_4h_3_R2.fastq.gz
     #1457.1_18h_
     ln -s ../F25A430000603-01_STAkimxP/1457.1_18h_MH/1457.1_18h_MH_1.fq.gz WT_MH_18h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.1_18h_MH/1457.1_18h_MH_2.fq.gz WT_MH_18h_1_R2.fastq.gz
     #1457.2_18h_
     ln -s ../F25A430000603-01_STAkimxP/1457.2_18h_MH/1457.2_18h_MH_1.fq.gz WT_MH_18h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.2_18h_MH/1457.2_18h_MH_2.fq.gz WT_MH_18h_2_R2.fastq.gz
     #1457.3_18h_
     ln -s ../F25A430000603-01_STAkimxP/1457.3_18h_MH/1457.3_18h_MH_1.fq.gz WT_MH_18h_3_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457.3_18h_MH/1457.3_18h_MH_2.fq.gz WT_MH_18h_3_R2.fastq.gz
     #1457dsbp1_2h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp1_2h_MH/1457dsbp1_2h_MH_1.fq.gz deltasbp_MH_2h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp1_2h_MH/1457dsbp1_2h_MH_2.fq.gz deltasbp_MH_2h_1_R2.fastq.gz
     #1457dsbp2_2h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp2_2h_MH/1457dsbp2_2h_MH_1.fq.gz deltasbp_MH_2h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp2_2h_MH/1457dsbp2_2h_MH_2.fq.gz deltasbp_MH_2h_2_R2.fastq.gz
     #1457dsbp3_2h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp3_2h_MH/1457dsbp3_2h_MH_1.fq.gz deltasbp_MH_2h_3_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp3_2h_MH/1457dsbp3_2h_MH_2.fq.gz deltasbp_MH_2h_3_R2.fastq.gz
     #1457dsbp1_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp1_4h_MH/1457dsbp1_4h_MH_1.fq.gz deltasbp_MH_4h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp1_4h_MH/1457dsbp1_4h_MH_2.fq.gz deltasbp_MH_4h_1_R2.fastq.gz
     #1457dsbp2_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp2_4h_MH/1457dsbp2_4h_MH_1.fq.gz deltasbp_MH_4h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp2_4h_MH/1457dsbp2_4h_MH_2.fq.gz deltasbp_MH_4h_2_R2.fastq.gz
     #1457dsbp3_4h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp3_4h_MH/1457dsbp3_4h_MH_1.fq.gz deltasbp_MH_4h_3_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp3_4h_MH/1457dsbp3_4h_MH_2.fq.gz deltasbp_MH_4h_3_R2.fastq.gz
     #1457dsbp118h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp118h_MH/1457dsbp118h_MH_1.fq.gz deltasbp_MH_18h_1_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp118h_MH/1457dsbp118h_MH_2.fq.gz deltasbp_MH_18h_1_R2.fastq.gz
     #1457dsbp218h_
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp218h_MH/1457dsbp218h_MH_1.fq.gz deltasbp_MH_18h_2_R1.fastq.gz
     ln -s ../F25A430000603-01_STAkimxP/1457dsbp218h_MH/1457dsbp218h_MH_2.fq.gz deltasbp_MH_18h_2_R2.fastq.gz
    
     #1457.1_2h_
     ln -s ../F25A430000603_STAmsvaP/1457.1_2h_TSB/1457.1_2h_TSB_1.fq.gz  WT_TSB_2h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.1_2h_TSB/1457.1_2h_TSB_2.fq.gz  WT_TSB_2h_1_R2.fastq.gz
     #1457.2_2h_
     ln -s ../F25A430000603_STAmsvaP/1457.2_2h_TSB/1457.2_2h_TSB_1.fq.gz  WT_TSB_2h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.2_2h_TSB/1457.2_2h_TSB_2.fq.gz  WT_TSB_2h_2_R2.fastq.gz
     #1457.3_2h_
     ln -s ../F25A430000603_STAmsvaP/1457.3_2h_TSB/1457.3_2h_TSB_1.fq.gz  WT_TSB_2h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.3_2h_TSB/1457.3_2h_TSB_2.fq.gz  WT_TSB_2h_3_R2.fastq.gz
     #1457.1_4h_
     ln -s ../F25A430000603_STAmsvaP/1457.1_4h_TSB/1457.1_4h_TSB_1.fq.gz  WT_TSB_4h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.1_4h_TSB/1457.1_4h_TSB_2.fq.gz  WT_TSB_4h_1_R2.fastq.gz
     #1457.2_4h_
     ln -s ../F25A430000603_STAmsvaP/1457.2_4h_TSB/1457.2_4h_TSB_1.fq.gz  WT_TSB_4h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.2_4h_TSB/1457.2_4h_TSB_2.fq.gz  WT_TSB_4h_2_R2.fastq.gz
     #1457.3_4h_
     ln -s ../F25A430000603_STAmsvaP/1457.3_4h_TSB/1457.3_4h_TSB_1.fq.gz  WT_TSB_4h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.3_4h_TSB/1457.3_4h_TSB_2.fq.gz  WT_TSB_4h_3_R2.fastq.gz
     #1457.1_18h_
     ln -s ../F25A430000603_STAmsvaP/1457.1_18h_TSB/1457.1_18h_TSB_1.fq.gz  WT_TSB_18h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.1_18h_TSB/1457.1_18h_TSB_2.fq.gz  WT_TSB_18h_1_R2.fastq.gz
     #1457.2_18h_
     ln -s ../F25A430000603_STAmsvaP/1457.2_18h_TSB/1457.2_18h_TSB_1.fq.gz  WT_TSB_18h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.2_18h_TSB/1457.2_18h_TSB_2.fq.gz  WT_TSB_18h_2_R2.fastq.gz
     #1457.3_18h_
     ln -s ../F25A430000603_STAmsvaP/1457.3_18h_TSB/1457.3_18h_TSB_1.fq.gz  WT_TSB_18h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457.3_18h_TSB/1457.3_18h_TSB_2.fq.gz  WT_TSB_18h_3_R2.fastq.gz
     #1457dsbp1_2h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp1_2hTSB/1457dsbp1_2hTSB_1.fq.gz deltasbp_TSB_2h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp1_2hTSB/1457dsbp1_2hTSB_2.fq.gz deltasbp_TSB_2h_1_R2.fastq.gz
     #1457dsbp2_2h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp2_2hTSB/1457dsbp2_2hTSB_1.fq.gz deltasbp_TSB_2h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp2_2hTSB/1457dsbp2_2hTSB_2.fq.gz deltasbp_TSB_2h_2_R2.fastq.gz
     #1457dsbp3_2h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp3_2hTSB/1457dsbp3_2hTSB_1.fq.gz deltasbp_TSB_2h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp3_2hTSB/1457dsbp3_2hTSB_2.fq.gz deltasbp_TSB_2h_3_R2.fastq.gz
     #1457dsbp1_4h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp1_4hTSB/1457dsbp1_4hTSB_1.fq.gz deltasbp_TSB_4h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp1_4hTSB/1457dsbp1_4hTSB_2.fq.gz deltasbp_TSB_4h_1_R2.fastq.gz
     #1457dsbp2_4h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp2_4hTSB/1457dsbp2_4hTSB_1.fq.gz deltasbp_TSB_4h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp2_4hTSB/1457dsbp2_4hTSB_2.fq.gz deltasbp_TSB_4h_2_R2.fastq.gz
     #1457dsbp3_4h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp3_4hTSB/1457dsbp3_4hTSB_1.fq.gz deltasbp_TSB_4h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp3_4hTSB/1457dsbp3_4hTSB_2.fq.gz deltasbp_TSB_4h_3_R2.fastq.gz
     #1457dsbp1_18h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp118hTSB/1457dsbp118hTSB_1.fq.gz deltasbp_TSB_18h_1_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp118hTSB/1457dsbp118hTSB_2.fq.gz deltasbp_TSB_18h_1_R2.fastq.gz
     #1457dsbp2_18h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp218hTSB/1457dsbp218hTSB_1.fq.gz deltasbp_TSB_18h_2_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp218hTSB/1457dsbp218hTSB_2.fq.gz deltasbp_TSB_18h_2_R2.fastq.gz
     #1457dsbp3_18h_
     ln -s ../F25A430000603_STAmsvaP/1457dsbp318hTSB/1457dsbp318hTSB_1.fq.gz deltasbp_TSB_18h_3_R1.fastq.gz
     ln -s ../F25A430000603_STAmsvaP/1457dsbp318hTSB/1457dsbp318hTSB_2.fq.gz deltasbp_TSB_18h_3_R2.fastq.gz
     #END
  4. Preparing the directory trimmed

     mkdir trimmed trimmed_unpaired;
     for sample_id in WT_MH_2h_1 WT_MH_2h_2 WT_MH_2h_3 WT_MH_4h_1 WT_MH_4h_2 WT_MH_4h_3 WT_MH_18h_1 WT_MH_18h_2 WT_MH_18h_3 WT_TSB_2h_1 WT_TSB_2h_2 WT_TSB_2h_3 WT_TSB_4h_1 WT_TSB_4h_2 WT_TSB_4h_3 WT_TSB_18h_1 WT_TSB_18h_2 WT_TSB_18h_3  deltasbp_MH_2h_1 deltasbp_MH_2h_2 deltasbp_MH_2h_3 deltasbp_MH_4h_1 deltasbp_MH_4h_2 deltasbp_MH_4h_3 deltasbp_MH_18h_1 deltasbp_MH_18h_2 deltasbp_TSB_2h_1 deltasbp_TSB_2h_2 deltasbp_TSB_2h_3 deltasbp_TSB_4h_1 deltasbp_TSB_4h_2 deltasbp_TSB_4h_3 deltasbp_TSB_18h_1 deltasbp_TSB_18h_2 deltasbp_TSB_18h_3; do
             java -jar /home/jhuang/Tools/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 100 raw_data/${sample_id}_R1.fastq.gz raw_data/${sample_id}_R2.fastq.gz trimmed/${sample_id}_R1.fastq.gz trimmed_unpaired/${sample_id}_R1.fastq.gz trimmed/${sample_id}_R2.fastq.gz trimmed_unpaired/${sample_id}_R2.fastq.gz ILLUMINACLIP:/home/jhuang/Tools/Trimmomatic-0.36/adapters/TruSeq3-PE-2.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 AVGQUAL:20; done 2> trimmomatic_pe.log;
     done
     mv trimmed/*.fastq.gz .
  5. Preparing samplesheet.csv

     sample,fastq_1,fastq_2,strandedness
     WT_MH_2h_1,WT_MH_2h_1_R1.fastq.gz,WT_MH_2h_1_R2.fastq.gz,auto
     ...
  6. nextflow run

     #See an example: http://xgenes.com/article/article-content/157/prepare-virus-gtf-for-nextflow-run/
     #docker pull nfcore/rnaseq
     ln -s /home/jhuang/Tools/nf-core-rnaseq-3.12.0/ rnaseq
    
     # -- DEBUG_1 (CDS --> exon in CP020463.gff) --
     grep -P "\texon\t" CP020463.gff | sort | wc -l    #=81
     grep -P "cmsearch\texon\t" CP020463.gff | wc -l   #=11  ignal recognition particle sRNA small typ, transfer-messenger RNA, 5S ribosomal RNA
     grep -P "Genbank\texon\t" CP020463.gff | wc -l    #=12  16S and 23S ribosomal RNA
     grep -P "tRNAscan-SE\texon\t" CP020463.gff | wc -l    #tRNA 58
     grep -P "\tCDS\t" CP020463.gff | wc -l  #3701-->2324
     sed 's/\tCDS\t/\texon\t/g' CP020463.gff > CP020463_m.gff
     grep -P "\texon\t" CP020463_m.gff | sort | wc -l  #3797-->2405
    
     # -- NOTE that combination of 'CP020463_m.gff' and 'exon' in the command will result in ERROR, using 'transcript' instead in the command line!
     --gff "/home/jhuang/DATA/Data_Tam_RNAseq_2024/CP020463_m.gff" --featurecounts_feature_type 'transcript'
    
     # ---- SUCCESSFUL with directly downloaded gff3 and fasta from NCBI using docker after replacing 'CDS' with 'exon' ----
     (host_env) /usr/local/bin/nextflow run rnaseq/main.nf --input samplesheet.csv --outdir results    --fasta "/home/jhuang/DATA/Data_Michelle_RNAseq_2025/CP020463.fasta" --gff "/home/jhuang/DATA/Data_Michelle_RNAseq_2025/CP020463_m.gff"        -profile docker -resume  --max_cpus 55 --max_memory 512.GB --max_time 2400.h    --save_align_intermeds --save_unaligned --save_reference    --aligner 'star_salmon'    --gtf_group_features 'gene_id'  --gtf_extra_attributes 'gene_name' --featurecounts_group_type 'gene_biotype' --featurecounts_feature_type 'transcript'
    
     # -- DEBUG_3: make sure the header of fasta is the same to the *_m.gff file, both are "CP020463.1"
  7. Import data and pca-plot

     #mamba activate r_env
    
     #install.packages("ggfun")
     # Import the required libraries
     library("AnnotationDbi")
     library("clusterProfiler")
     library("ReactomePA")
     library(gplots)
     library(tximport)
     library(DESeq2)
     #library("org.Hs.eg.db")
     library(dplyr)
     library(tidyverse)
     #install.packages("devtools")
     #devtools::install_version("gtable", version = "0.3.0")
     library(gplots)
     library("RColorBrewer")
     #install.packages("ggrepel")
     library("ggrepel")
     # install.packages("openxlsx")
     library(openxlsx)
     library(EnhancedVolcano)
     library(DESeq2)
     library(edgeR)
    
     setwd("~/DATA/Data_Michelle_RNAseq_2025/results/star_salmon")
     # Define paths to your Salmon output quantification files
     files <- c(
             "deltasbp_MH_2h_r1" = "./deltasbp_MH_2h_1/quant.sf",
             "deltasbp_MH_2h_r2" = "./deltasbp_MH_2h_2/quant.sf",
             "deltasbp_MH_2h_r3" = "./deltasbp_MH_2h_3/quant.sf",
             "deltasbp_MH_4h_r1" = "./deltasbp_MH_4h_1/quant.sf",
             "deltasbp_MH_4h_r2" = "./deltasbp_MH_4h_2/quant.sf",
             "deltasbp_MH_4h_r3" = "./deltasbp_MH_4h_3/quant.sf",
             "deltasbp_MH_18h_r1" = "./deltasbp_MH_18h_1/quant.sf",
             "deltasbp_MH_18h_r2" = "./deltasbp_MH_18h_2/quant.sf",
             "deltasbp_TSB_2h_r1" = "./deltasbp_TSB_2h_1/quant.sf",
             "deltasbp_TSB_2h_r2" = "./deltasbp_TSB_2h_2/quant.sf",
             "deltasbp_TSB_2h_r3" = "./deltasbp_TSB_2h_3/quant.sf",
             "deltasbp_TSB_4h_r1" = "./deltasbp_TSB_4h_1/quant.sf",
             "deltasbp_TSB_4h_r2" = "./deltasbp_TSB_4h_2/quant.sf",
             "deltasbp_TSB_4h_r3" = "./deltasbp_TSB_4h_3/quant.sf",
             "deltasbp_TSB_18h_r1" = "./deltasbp_TSB_18h_1/quant.sf",
             "deltasbp_TSB_18h_r2" = "./deltasbp_TSB_18h_2/quant.sf",
             "deltasbp_TSB_18h_r3" = "./deltasbp_TSB_18h_3/quant.sf",
             "WT_MH_2h_r1" = "./WT_MH_2h_1/quant.sf",
             "WT_MH_2h_r2" = "./WT_MH_2h_2/quant.sf",
             "WT_MH_2h_r3" = "./WT_MH_2h_3/quant.sf",
             "WT_MH_4h_r1" = "./WT_MH_4h_1/quant.sf",
             "WT_MH_4h_r2" = "./WT_MH_4h_2/quant.sf",
             "WT_MH_4h_r3" = "./WT_MH_4h_3/quant.sf",
             "WT_MH_18h_r1" = "./WT_MH_18h_1/quant.sf",
             "WT_MH_18h_r2" = "./WT_MH_18h_2/quant.sf",
             "WT_MH_18h_r3" = "./WT_MH_18h_3/quant.sf",
             "WT_TSB_2h_r1" = "./WT_TSB_2h_1/quant.sf",
             "WT_TSB_2h_r2" = "./WT_TSB_2h_2/quant.sf",
             "WT_TSB_2h_r3" = "./WT_TSB_2h_3/quant.sf",
             "WT_TSB_4h_r1" = "./WT_TSB_4h_1/quant.sf",
             "WT_TSB_4h_r2" = "./WT_TSB_4h_2/quant.sf",
             "WT_TSB_4h_r3" = "./WT_TSB_4h_3/quant.sf",
             "WT_TSB_18h_r1" = "./WT_TSB_18h_1/quant.sf",
             "WT_TSB_18h_r2" = "./WT_TSB_18h_2/quant.sf",
             "WT_TSB_18h_r3" = "./WT_TSB_18h_3/quant.sf")
    
     # Import the transcript abundance data with tximport
     txi <- tximport(files, type = "salmon", txIn = TRUE, txOut = TRUE)
     # Define the replicates and condition of the samples
     replicate <- factor(c("r1","r2","r3", "r1","r2","r3", "r1","r2", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3", "r1","r2","r3"))
     condition <- factor(c("deltasbp_MH_2h","deltasbp_MH_2h","deltasbp_MH_2h","deltasbp_MH_4h","deltasbp_MH_4h","deltasbp_MH_4h","deltasbp_MH_18h","deltasbp_MH_18h","deltasbp_TSB_2h","deltasbp_TSB_2h","deltasbp_TSB_2h","deltasbp_TSB_4h","deltasbp_TSB_4h","deltasbp_TSB_4h","deltasbp_TSB_18h","deltasbp_TSB_18h","deltasbp_TSB_18h","WT_MH_2h","WT_MH_2h","WT_MH_2h","WT_MH_4h","WT_MH_4h","WT_MH_4h","WT_MH_18h","WT_MH_18h","WT_MH_18h","WT_TSB_2h","WT_TSB_2h","WT_TSB_2h","WT_TSB_4h","WT_TSB_4h","WT_TSB_4h","WT_TSB_18h","WT_TSB_18h","WT_TSB_18h"))
    
     sample_table <- data.frame(
         condition = condition,
         replicate = replicate
     )
     split_cond <- do.call(rbind, strsplit(as.character(condition), "_"))
     colnames(split_cond) <- c("strain", "media", "time")
     colData <- cbind(sample_table, split_cond)
     colData$strain <- factor(colData$strain)
     colData$media  <- factor(colData$media)
     colData$time   <- factor(colData$time)
     #colData$group  <- factor(paste(colData$strain, colData$media, colData$time, sep = "_"))
     # Define the colData for DESeq2
     #colData <- data.frame(condition=condition, row.names=names(files))
    
     #grep "gene_name" ./results/genome/CP059040_m.gtf | wc -l  #1701
     #grep "gene_name" ./results/genome/CP020463_m.gtf | wc -l  #50
    
     #dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition + batch)
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
    
     # ------------------------
     # 1️⃣ Setup and input files
     # ------------------------
    
     # Read in transcript-to-gene mapping
     tx2gene <- read.table("salmon_tx2gene.tsv", header=FALSE, stringsAsFactors=FALSE)
     colnames(tx2gene) <- c("transcript_id", "gene_id", "gene_name")
    
     # Prepare tx2gene for gene-level summarization (remove gene_name if needed)
     tx2gene_geneonly <- tx2gene[, c("transcript_id", "gene_id")]
    
     # -------------------------------
     # 2️⃣ Transcript-level counts
     # -------------------------------
     # Create DESeqDataSet directly from tximport (transcript-level)
     dds_tx <- DESeqDataSetFromTximport(txi, colData=colData, design=~condition)
     write.csv(counts(dds_tx), file="transcript_counts.csv")
    
     # --------------------------------
     # 3️⃣ Gene-level summarization
     # --------------------------------
     # Re-import Salmon data summarized at gene level
     txi_gene <- tximport(files, type="salmon", tx2gene=tx2gene_geneonly, txOut=FALSE)
    
     # Create DESeqDataSet for gene-level counts
     #dds <- DESeqDataSetFromTximport(txi_gene, colData=colData, design=~condition+replicate)
     dds <- DESeqDataSetFromTximport(txi_gene, colData=colData, design=~condition)
     #dds <- DESeqDataSetFromTximport(txi, colData = colData, design = ~ time + media + strain + media:strain + strain:time)
     #或更简单地写为(推荐):dds <- DESeqDataSetFromTximport(txi, colData = colData, design = ~ time + media * strain)
     #dds <- DESeqDataSetFromTximport(txi, colData = colData, design = ~ strain * media * time)
     #~ strain * media * time    主效应 + 所有交互(推荐)  ✅
     #~ time + media * strain    主效应 + media:strain 交互   ⚠️ 有限制
    
     # --------------------------------
     # 4️⃣ Raw counts table (with gene names)
     # --------------------------------
     # Extract raw gene-level counts
     counts_data <- as.data.frame(counts(dds, normalized=FALSE))
     counts_data$gene_id <- rownames(counts_data)
    
     # Add gene names
     tx2gene_unique <- unique(tx2gene[, c("gene_id", "gene_name")])
     counts_data <- merge(counts_data, tx2gene_unique, by="gene_id", all.x=TRUE)
    
     # Reorder columns: gene_id, gene_name, then counts
     count_cols <- setdiff(colnames(counts_data), c("gene_id", "gene_name"))
     counts_data <- counts_data[, c("gene_id", "gene_name", count_cols)]
    
     # --------------------------------
     # 5️⃣ Calculate CPM
     # --------------------------------
     library(edgeR)
     library(openxlsx)
    
     # Prepare count matrix for CPM calculation
     count_matrix <- as.matrix(counts_data[, !(colnames(counts_data) %in% c("gene_id", "gene_name"))])
    
     # Calculate CPM
     #cpm_matrix <- cpm(count_matrix, normalized.lib.sizes=FALSE)
     total_counts <- colSums(count_matrix)
     cpm_matrix <- t(t(count_matrix) / total_counts) * 1e6
     cpm_matrix <- as.data.frame(cpm_matrix)
    
     # Add gene_id and gene_name back to CPM table
     cpm_counts <- cbind(counts_data[, c("gene_id", "gene_name")], cpm_matrix)
    
     # --------------------------------
     # 6️⃣ Save outputs
     # --------------------------------
     write.csv(counts_data, "gene_raw_counts.csv", row.names=FALSE)
     write.xlsx(counts_data, "gene_raw_counts.xlsx", row.names=FALSE)
     write.xlsx(cpm_counts, "gene_cpm_counts.xlsx", row.names=FALSE)
    
     # -- Save the rlog-transformed counts --
     dim(counts(dds))
     head(counts(dds), 10)
     rld <- rlogTransformation(dds)
     rlog_counts <- assay(rld)
     write.xlsx(as.data.frame(rlog_counts), "gene_rlog_transformed_counts.xlsx")
    
     # -- pca --
     png("pca2.png", 1200, 800)
     plotPCA(rld, intgroup=c("condition"))
     dev.off()
     # -- heatmap --
     png("heatmap2.png", 1200, 800)
     distsRL <- dist(t(assay(rld)))
     mat <- as.matrix(distsRL)
     hc <- hclust(distsRL)
     hmcol <- colorRampPalette(brewer.pal(9,"GnBu"))(100)
     heatmap.2(mat, Rowv=as.dendrogram(hc),symm=TRUE, trace="none",col = rev(hmcol), margin=c(13, 13))
     dev.off()
    
     # -- pca_media_strain --
     png("pca_media.png", 1200, 800)
     plotPCA(rld, intgroup=c("media"))
     dev.off()
     png("pca_strain.png", 1200, 800)
     plotPCA(rld, intgroup=c("strain"))
     dev.off()
     png("pca_time.png", 1200, 800)
     plotPCA(rld, intgroup=c("time"))
     dev.off()
  8. (Optional; ERROR–>need to be debugged!) ) estimate size factors and dispersion values.

     #Size Factors: These are used to normalize the read counts across different samples. The size factor for a sample accounts for differences in sequencing depth (i.e., the total number of reads) and other technical biases between samples. After normalization with size factors, the counts should be comparable across samples. Size factors are usually calculated in a way that they reflect the median or mean ratio of gene expression levels between samples, assuming that most genes are not differentially expressed.
     #Dispersion: This refers to the variability or spread of gene expression measurements. In RNA-seq data analysis, each gene has its own dispersion value, which reflects how much the counts for that gene vary between different samples, more than what would be expected just due to the Poisson variation inherent in counting. Dispersion is important for accurately modeling the data and for detecting differentially expressed genes.
     #So in summary, size factors are specific to samples (used to make counts comparable across samples), and dispersion values are specific to genes (reflecting variability in gene expression).
    
     sizeFactors(dds)
     #NULL
     # Estimate size factors
     dds <- estimateSizeFactors(dds)
     # Estimate dispersions
     dds <- estimateDispersions(dds)
     #> sizeFactors(dds)
    
     #control_r1 control_r2  HSV.d2_r1  HSV.d2_r2  HSV.d4_r1  HSV.d4_r2  HSV.d6_r1
     #2.3282468  2.0251928  1.8036883  1.3767551  0.9341929  1.0911693  0.5454526
     #HSV.d6_r2  HSV.d8_r1  HSV.d8_r2
     #0.4604461  0.5799834  0.6803681
    
     # (DEBUG) If avgTxLength is Necessary
     #To simplify the computation and ensure sizeFactors are calculated:
     assays(dds)$avgTxLength <- NULL
     dds <- estimateSizeFactors(dds)
     sizeFactors(dds)
     #If you want to retain avgTxLength but suspect it is causing issues, you can explicitly instruct DESeq2 to compute size factors without correcting for library size with average transcript lengths:
     dds <- estimateSizeFactors(dds, controlGenes = NULL, use = FALSE)
     sizeFactors(dds)
    
     # If alone with virus data, the following BUG occured:
     #Still NULL --> BUG --> using manual calculation method for sizeFactor calculation!
                         HeLa_TO_r1                      HeLa_TO_r2
                         0.9978755                       1.1092227
     data.frame(genes = rownames(dds), dispersions = dispersions(dds))
    
     #Given the raw counts, the control_r1 and control_r2 samples seem to have a much lower sequencing depth (total read count) than the other samples. Therefore, when normalization methods are applied, the normalization factors for these control samples will be relatively high, boosting the normalized counts.
     1/0.9978755=1.002129023
     1/1.1092227=
     #bamCoverage --bam ../markDuplicates/${sample}Aligned.sortedByCoord.out.bam -o ${sample}_norm.bw --binSize 10 --scaleFactor  --effectiveGenomeSize 2864785220
     bamCoverage --bam ../markDuplicates/HeLa_TO_r1Aligned.sortedByCoord.out.markDups.bam -o HeLa_TO_r1.bw --binSize 10 --scaleFactor 1.002129023     --effectiveGenomeSize 2864785220
     bamCoverage --bam ../markDuplicates/HeLa_TO_r2Aligned.sortedByCoord.out.markDups.bam -o HeLa_TO_r2.bw --binSize 10 --scaleFactor  0.901532217        --effectiveGenomeSize 2864785220
    
     raw_counts <- counts(dds)
     normalized_counts <- counts(dds, normalized=TRUE)
     #write.table(raw_counts, file="raw_counts.txt", sep="\t", quote=F, col.names=NA)
     #write.table(normalized_counts, file="normalized_counts.txt", sep="\t", quote=F, col.names=NA)
     #convert bam to bigwig using deepTools by feeding inverse of DESeq’s size Factor
     estimSf <- function (cds){
         # Get the count matrix
         cts <- counts(cds)
         # Compute the geometric mean
         geomMean <- function(x) prod(x)^(1/length(x))
         # Compute the geometric mean over the line
         gm.mean  <-  apply(cts, 1, geomMean)
         # Zero values are set to NA (avoid subsequentcdsdivision by 0)
         gm.mean[gm.mean == 0] <- NA
         # Divide each line by its corresponding geometric mean
         # sweep(x, MARGIN, STATS, FUN = "-", check.margin = TRUE, ...)
         # MARGIN: 1 or 2 (line or columns)
         # STATS: a vector of length nrow(x) or ncol(x), depending on MARGIN
         # FUN: the function to be applied
         cts <- sweep(cts, 1, gm.mean, FUN="/")
         # Compute the median over the columns
         med <- apply(cts, 2, median, na.rm=TRUE)
         # Return the scaling factor
         return(med)
     }
     #https://dputhier.github.io/ASG/practicals/rnaseq_diff_Snf2/rnaseq_diff_Snf2.html
     #http://bioconductor.org/packages/devel/bioc/vignettes/DESeq2/inst/doc/DESeq2.html#data-transformations-and-visualization
     #https://hbctraining.github.io/DGE_workshop/lessons/02_DGE_count_normalization.html
     #https://hbctraining.github.io/DGE_workshop/lessons/04_DGE_DESeq2_analysis.html
     #https://genviz.org/module-04-expression/0004/02/01/DifferentialExpression/
     #DESeq2’s median of ratios [1]
     #EdgeR’s trimmed mean of M values (TMM) [2]
     #http://www.nathalievialaneix.eu/doc/html/TP1_normalization.html  #very good website!
     test_normcount <- sweep(raw_counts, 2, sizeFactors(dds), "/")
     sum(test_normcount != normalized_counts)
  9. Select the differentially expressed genes

     #https://galaxyproject.eu/posts/2020/08/22/three-steps-to-galaxify-your-tool/
     #https://www.biostars.org/p/282295/
     #https://www.biostars.org/p/335751/
     dds$condition
     [1] deltasbp_MH_2h   deltasbp_MH_2h   deltasbp_MH_2h   deltasbp_MH_4h
     [5] deltasbp_MH_4h   deltasbp_MH_4h   deltasbp_MH_18h  deltasbp_MH_18h
     [9] deltasbp_TSB_2h  deltasbp_TSB_2h  deltasbp_TSB_2h  deltasbp_TSB_4h
     [13] deltasbp_TSB_4h  deltasbp_TSB_4h  deltasbp_TSB_18h deltasbp_TSB_18h
     [17] deltasbp_TSB_18h WT_MH_2h         WT_MH_2h         WT_MH_2h
     [21] WT_MH_4h         WT_MH_4h         WT_MH_4h         WT_MH_18h
     [25] WT_MH_18h        WT_MH_18h        WT_TSB_2h        WT_TSB_2h
     [29] WT_TSB_2h        WT_TSB_4h        WT_TSB_4h        WT_TSB_4h
     [33] WT_TSB_18h       WT_TSB_18h       WT_TSB_18h
     12 Levels: deltasbp_MH_18h deltasbp_MH_2h deltasbp_MH_4h ... WT_TSB_4h
    
     #CONSOLE: mkdir star_salmon/degenes
    
     setwd("degenes")
    
     # 确保因子顺序(可选)
     colData$strain <- relevel(factor(colData$strain), ref = "WT")
     colData$media  <- relevel(factor(colData$media), ref = "TSB")
     colData$time   <- relevel(factor(colData$time), ref = "2h")
    
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ strain * media * time)
     dds <- DESeq(dds, betaPrior = FALSE)
     resultsNames(dds)
     #[1] "Intercept"                      "strain_deltasbp_vs_WT"
     #[3] "media_MH_vs_TSB"                "time_18h_vs_2h"
     #[5] "time_4h_vs_2h"                  "straindeltasbp.mediaMH"
     #[7] "straindeltasbp.time18h"         "straindeltasbp.time4h"
     #[9] "mediaMH.time18h"                "mediaMH.time4h"
     #[11] "straindeltasbp.mediaMH.time18h" "straindeltasbp.mediaMH.time4h"
    
     🔹 Main effects for each factor:
    
     表达量
     ▲
     │       ┌────── WT-TSB
     │      /
     │     /     ┌────── WT-MH
     │    /     /
     │   /     /     ┌────── deltasbp-TSB
     │  /     /     /
     │ /     /     /     ┌────── deltasbp-MH
     └──────────────────────────────▶ 时间(2h, 4h, 18h)
    
         * strain_deltasbp_vs_WT
         * media_MH_vs_TSB
         * time_18h_vs_2h
         * time_4h_vs_2h
    
     🔹 两因素交互作用(Two-way interactions)
     这些项表示两个实验因素(如菌株、培养基、时间)之间的组合效应——也就是说,其中一个因素的影响取决于另一个因素的水平。
    
     表达量
     ▲
     │
     │             WT ────────┐
     │                        └─↘
     │                           ↘
     │                        deltasbp ←←←← 显著交互(方向/幅度不同)
     └──────────────────────────────▶ 时间
    
     straindeltasbp.mediaMH
     表示 菌株(strain)和培养基(media)之间的交互作用。
     ➤ 这意味着:deltasbp 这个突变菌株在 MH 培养基中的表现与它在 TSB 中的不同,不能仅通过菌株和培养基的单独效应来解释。
    
     straindeltasbp.time18h
     表示 菌株(strain)和时间(time, 18h)之间的交互作用。
     ➤ 即:突变菌株在 18 小时时的表达变化不只是菌株效应或时间效应的简单相加,而有协同作用。
    
     straindeltasbp.time4h
     同上,是菌株和时间(4h)之间的交互作用。
    
     mediaMH.time18h
     表示 培养基(MH)与时间(18h)之间的交互作用。
     ➤ 即:在 MH 培养基中,18 小时时的表达水平与在其他时间点(例如 2h)不同,且该变化不完全可以用时间和培养基各自单独的效应来解释。
    
     mediaMH.time4h
     与上面类似,是 MH 培养基与 4 小时之间的交互作用。
    
     🔹 三因素交互作用(Three-way interactions)
     三因素交互作用表示:菌株、培养基和时间这三个因素在一起时,会产生一个新的效应,这种效应无法通过任何两个因素的组合来完全解释。
    
     表达量(TSB)
     ▲
     │
     │        WT ──────→→
     │        deltasbp ─────→→
     └────────────────────────▶ 时间(2h, 4h, 18h)
    
     表达量(MH)
     ▲
     │
     │        WT ──────→→
     │        deltasbp ─────⬈⬈⬈⬈⬈⬈⬈
     └────────────────────────▶ 时间(2h, 4h, 18h)
    
     straindeltasbp.mediaMH.time18h
     表示 菌株 × 培养基 × 时间(18h) 三者之间的交互作用。
     ➤ 即:突变菌株在 MH 培养基下的 18 小时表达模式,与其他组合(比如 WT 在 MH 培养基下,或者在 TSB 下)都不相同。
    
     straindeltasbp.mediaMH.time4h
     同上,只是观察的是 4 小时下的三因素交互效应。
    
     ✅ 总结:
     交互作用项的存在意味着你不能仅通过单个变量(如菌株、时间或培养基)的影响来解释基因表达的变化,必须同时考虑它们之间的组合关系。在 DESeq2 模型中,这些交互项的显著性可以揭示特定条件下是否有特异的调控行为。
    
     # 提取 strain 的主效应: up 2, down 16
     contrast <- "strain_deltasbp_vs_WT"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 media 的主效应: up 76; down 128
     contrast <- "media_MH_vs_TSB"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     # 提取 time 的主效应 up 228, down 98; up 17, down 2
     contrast <- "time_18h_vs_2h"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     contrast <- "time_4h_vs_2h"
     res = results(dds, name=contrast)
     res <- res[!is.na(res$log2FoldChange),]
     res_df <- as.data.frame(res)
     write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(contrast, "all.txt", sep="-"))
     up <- subset(res_df, padj<=0.05 & log2FoldChange>=2)
     down <- subset(res_df, padj<=0.05 & log2FoldChange<=-2)
     write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(contrast, "up.txt", sep="-"))
     write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(contrast, "down.txt", sep="-"))
    
     #1.)  delta sbp 2h TSB vs WT 2h TSB
     #2.)  delta sbp 4h TSB vs WT 4h TSB
     #3.)  delta sbp 18h TSB vs WT 18h TSB
     #4.)  delta sbp 2h MH vs WT 2h MH
     #5.)  delta sbp 4h MH vs WT 4h MH
     #6.)  delta sbp 18h MH vs WT 18h MH
    
     #---- relevel to control ----
     #design=~condition+replicate
     dds <- DESeqDataSetFromTximport(txi, colData, design = ~ condition)
     dds$condition <- relevel(dds$condition, "WT_TSB_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_TSB_2h_vs_WT_TSB_2h")
    
     dds$condition <- relevel(dds$condition, "WT_TSB_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_TSB_4h_vs_WT_TSB_4h")
    
     dds$condition <- relevel(dds$condition, "WT_TSB_18h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_TSB_18h_vs_WT_TSB_18h")
    
     dds$condition <- relevel(dds$condition, "WT_MH_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_MH_2h_vs_WT_MH_2h")
    
     dds$condition <- relevel(dds$condition, "WT_MH_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_MH_4h_vs_WT_MH_4h")
    
     dds$condition <- relevel(dds$condition, "WT_MH_18h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_MH_18h_vs_WT_MH_18h")
    
     # WT_MH_xh
     dds$condition <- relevel(dds$condition, "WT_MH_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_MH_4h_vs_WT_MH_2h", "WT_MH_18h_vs_WT_MH_2h")
     dds$condition <- relevel(dds$condition, "WT_MH_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_MH_18h_vs_WT_MH_4h")
    
     # WT_TSB_xh
     dds$condition <- relevel(dds$condition, "WT_TSB_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_TSB_4h_vs_WT_TSB_2h", "WT_TSB_18h_vs_WT_TSB_2h")
     dds$condition <- relevel(dds$condition, "WT_TSB_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("WT_TSB_18h_vs_WT_TSB_4h")
    
     # deltasbp_MH_xh
     dds$condition <- relevel(dds$condition, "deltasbp_MH_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_MH_4h_vs_deltasbp_MH_2h", "deltasbp_MH_18h_vs_deltasbp_MH_2h")
     dds$condition <- relevel(dds$condition, "deltasbp_MH_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_MH_18h_vs_deltasbp_MH_4h")
    
     # deltasbp_TSB_xh
     dds$condition <- relevel(dds$condition, "deltasbp_TSB_2h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_TSB_4h_vs_deltasbp_TSB_2h", "deltasbp_TSB_18h_vs_deltasbp_TSB_2h")
     dds$condition <- relevel(dds$condition, "deltasbp_TSB_4h")
     dds = DESeq(dds, betaPrior=FALSE)
     resultsNames(dds)
     clist <- c("deltasbp_TSB_18h_vs_deltasbp_TSB_4h")
    
     for (i in clist) {
       contrast = paste("condition", i, sep="_")
       #for_Mac_vs_LB  contrast = paste("media", i, sep="_")
       res = results(dds, name=contrast)
       res <- res[!is.na(res$log2FoldChange),]
       res_df <- as.data.frame(res)
    
       write.csv(as.data.frame(res_df[order(res_df$pvalue),]), file = paste(i, "all.txt", sep="-"))
       #res$log2FoldChange < -2 & res$padj < 5e-2
       up <- subset(res_df, padj<=0.01 & log2FoldChange>=2)
       down <- subset(res_df, padj<=0.01 & log2FoldChange<=-2)
       write.csv(as.data.frame(up[order(up$log2FoldChange,decreasing=TRUE),]), file = paste(i, "up.txt", sep="-"))
       write.csv(as.data.frame(down[order(abs(down$log2FoldChange),decreasing=TRUE),]), file = paste(i, "down.txt", sep="-"))
     }
    
     # -- Under host-env (mamba activate plot-numpy1) --
     mamba activate plot-numpy1
     grep -P "\tgene\t" CP020463.gff > CP020463_gene.gff
    
     for cmp in deltasbp_TSB_2h_vs_WT_TSB_2h deltasbp_TSB_4h_vs_WT_TSB_4h deltasbp_TSB_18h_vs_WT_TSB_18h deltasbp_MH_2h_vs_WT_MH_2h deltasbp_MH_4h_vs_WT_MH_4h deltasbp_MH_18h_vs_WT_MH_18h    WT_MH_4h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_4h WT_TSB_4h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_4h  deltasbp_MH_4h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_4h deltasbp_TSB_4h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_4h; do
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Michelle_RNAseq_2025/CP020463_gene.gff ${cmp}-all.txt ${cmp}-all.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Michelle_RNAseq_2025/CP020463_gene.gff ${cmp}-up.txt ${cmp}-up.csv
       python3 ~/Scripts/replace_gene_names.py /home/jhuang/DATA/Data_Michelle_RNAseq_2025/CP020463_gene.gff ${cmp}-down.txt ${cmp}-down.csv
     done
    
     # ---- delta sbp TSB 2h vs WT TSB 2h ----
     res <- read.csv("deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_2h_vs_WT_TSB_2h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_2h_vs_WT_TSB_2h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 2h versus WT TSB 2h"))
     dev.off()
    
     # ---- delta sbp TSB 4h vs WT TSB 4h ----
     res <- read.csv("deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_4h_vs_WT_TSB_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_4h_vs_WT_TSB_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 4h versus WT TSB 4h"))
     dev.off()
    
     # ---- delta sbp TSB 18h vs WT TSB 18h ----
     res <- read.csv("deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_TSB_18h_vs_WT_TSB_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_TSB_18h_vs_WT_TSB_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp TSB 18h versus WT TSB 18h"))
     dev.off()
    
     # ---- delta sbp MH 2h vs WT MH 2h ----
     res <- read.csv("deltasbp_MH_2h_vs_WT_MH_2h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
     #print(duplicated_genes)
     # [1] "bfr"  "lipA" "ahpF" "pcaF" "alr"  "pcaD" "cydB" "lpdA" "pgaC" "ppk1"
     #[11] "pcaF" "tuf"  "galE" "murI" "yccS" "rrf"  "rrf"  "arsB" "ptsP" "umuD"
     #[21] "map"  "pgaB" "rrf"  "rrf"  "rrf"  "pgaD" "uraH" "benE"
     #res[res$GeneName == "bfr", ]
    
     #1st_strategy First occurrence is kept and Subsequent duplicates are removed
     #res <- res[!duplicated(res$GeneName), ]
     #2nd_strategy keep the row with the smallest padj value for each GeneName
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_2h_vs_WT_MH_2h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     ## Ensure the data frame matches the expected format
     ## For example, it should have columns: log2FoldChange, padj, etc.
     #res <- as.data.frame(res)
     ## Remove rows with NA in log2FoldChange (if needed)
     #res <- res[!is.na(res$log2FoldChange),]
    
     # Replace padj = 0 with a small value
     #NO_SUCH_RECORDS: res$padj[res$padj == 0] <- 1e-150
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_2h_vs_WT_MH_2h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 2h versus WT MH 2h"))
     dev.off()
    
     # ---- delta sbp MH 4h vs WT MH 4h ----
     res <- read.csv("deltasbp_MH_4h_vs_WT_MH_4h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_4h_vs_WT_MH_4h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_4h_vs_WT_MH_4h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 4h versus WT MH 4h"))
     dev.off()
    
     # ---- delta sbp MH 18h vs WT MH 18h ----
     res <- read.csv("deltasbp_MH_18h_vs_WT_MH_18h-all.csv")
     # Replace empty GeneName with modified GeneID
     res$GeneName <- ifelse(
       res$GeneName == "" | is.na(res$GeneName),
       gsub("gene-", "", res$GeneID),
       res$GeneName
     )
     duplicated_genes <- res[duplicated(res$GeneName), "GeneName"]
    
     res <- res %>%
       group_by(GeneName) %>%
       slice_min(padj, with_ties = FALSE) %>%
       ungroup()
     res <- as.data.frame(res)
     # Sort res first by padj (ascending) and then by log2FoldChange (descending)
     res <- res[order(res$padj, -res$log2FoldChange), ]
    
     # Assuming res is your dataframe and already processed
     # Filter up-regulated genes: log2FoldChange > 2 and padj < 5e-2
     up_regulated <- res[res$log2FoldChange > 2 & res$padj < 5e-2, ]
     # Filter down-regulated genes: log2FoldChange < -2 and padj < 5e-2
     down_regulated <- res[res$log2FoldChange < -2 & res$padj < 5e-2, ]
     # Create a new workbook
     wb <- createWorkbook()
     # Add the complete dataset as the first sheet
     addWorksheet(wb, "Complete_Data")
     writeData(wb, "Complete_Data", res)
     # Add the up-regulated genes as the second sheet
     addWorksheet(wb, "Up_Regulated")
     writeData(wb, "Up_Regulated", up_regulated)
     # Add the down-regulated genes as the third sheet
     addWorksheet(wb, "Down_Regulated")
     writeData(wb, "Down_Regulated", down_regulated)
     # Save the workbook to a file
     saveWorkbook(wb, "Gene_Expression_Δsbp_MH_18h_vs_WT_MH_18h.xlsx", overwrite = TRUE)
    
     # Set the 'GeneName' column as row.names
     rownames(res) <- res$GeneName
     # Drop the 'GeneName' column since it's now the row names
     res$GeneName <- NULL
     head(res)
    
     #library(EnhancedVolcano)
     # Assuming res is already sorted and processed
     png("Δsbp_MH_18h_vs_WT_MH_18h.png", width=1200, height=1200)
     #max.overlaps = 10
     EnhancedVolcano(res,
                     lab = rownames(res),
                     x = 'log2FoldChange',
                     y = 'padj',
                     pCutoff = 5e-2,
                     FCcutoff = 2,
                     title = '',
                     subtitleLabSize = 18,
                     pointSize = 3.0,
                     labSize = 5.0,
                     colAlpha = 1,
                     legendIconSize = 4.0,
                     drawConnectors = TRUE,
                     widthConnectors = 0.5,
                     colConnectors = 'black',
                     subtitle = expression("Δsbp MH 18h versus WT MH 18h"))
     dev.off()
    
     #Annotate the Gene_Expression_xxx_vs_yyy.xlsx in the next steps (see below e.g. Gene_Expression_with_Annotations_Urine_vs_MHB.xlsx)

KEGG and GO annotations in non-model organisms

https://www.biobam.com/functional-analysis/

Blast2GO_workflow

10.1. Assign KEGG and GO Terms (see diagram above)

    Since your organism is non-model, standard R databases (org.Hs.eg.db, etc.) won’t work. You’ll need to manually retrieve KEGG and GO annotations.

    Option 1 (KEGG Terms): EggNog based on orthology and phylogenies

        EggNOG-mapper assigns both KEGG Orthology (KO) IDs and GO terms.

        Install EggNOG-mapper:

            mamba create -n eggnog_env python=3.8 eggnog-mapper -c conda-forge -c bioconda  #eggnog-mapper_2.1.12
            mamba activate eggnog_env

        Run annotation:

            #diamond makedb --in eggnog6.prots.faa -d eggnog_proteins.dmnd
            mkdir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            download_eggnog_data.py --dbname eggnog.db -y --data_dir /home/jhuang/mambaforge/envs/eggnog_env/lib/python3.8/site-packages/data/
            #NOT_WORKING: emapper.py -i CP020463_gene.fasta -o eggnog_dmnd_out --cpu 60 -m diamond[hmmer,mmseqs] --dmnd_db /home/jhuang/REFs/eggnog_data/data/eggnog_proteins.dmnd
            #Download the protein sequences from Genbank
            mv ~/Downloads/sequence\ \(3\).txt CP020463_protein_.fasta
            python ~/Scripts/update_fasta_header.py CP020463_protein_.fasta CP020463_protein.fasta
            emapper.py -i CP020463_protein.fasta -o eggnog_out --cpu 60  #--resume
            #----> result annotations.tsv: Contains KEGG, GO, and other functional annotations.
            #---->  470.IX87_14445:
                * 470 likely refers to the organism or strain (e.g., Acinetobacter baumannii ATCC 19606 or another related strain).
                * IX87_14445 would refer to a specific gene or protein within that genome.

        Extract KEGG KO IDs from annotations.emapper.annotations.

    Option 2 (GO Terms from 'Blast2GO 5 Basic', saved in blast2go_annot.annot): Using Blast/Diamond + Blast2GO_GUI based on sequence alignment + GO mapping

    * jhuang@WS-2290C:~/DATA/Data_Michelle_RNAseq_2025$ ~/Tools/Blast2GO/Blast2GO_Launcher setting the workspace "mkdir ~/b2gWorkspace_Michelle_RNAseq_2025"; cp /mnt/md1/DATA/Data_Michelle_RNAseq_2025/results/star_salmon/degenes/CP020463_protein.fasta ~/b2gWorkspace_Michelle_RNAseq_2025
    * 'Load protein sequences' (Tags: NONE, generated columns: Nr, SeqName) by choosing the file CP020463_protein.fasta as input -->
    * Buttons 'blast' at the NCBI (Parameters: blastp, nr, ...) (Tags: BLASTED, generated columns: Description, Length, #Hits, e-Value, sim mean),
            QBlast finished with warnings!
            Blasted Sequences: 2084
            Sequences without results: 105
            Check the Job log for details and try to submit again.
            Restarting QBlast may result in additional results, depending on the error type.
            "Blast (CP020463_protein) Done"
    * Button 'mapping' (Tags: MAPPED, generated columns: #GO, GO IDs, GO Names), "Mapping finished - Please proceed now to annotation."
            "Mapping (CP020463_protein) Done"
            "Mapping finished - Please proceed now to annotation."
    * Button 'annot' (Tags: ANNOTATED, generated columns: Enzyme Codes, Enzyme Names), "Annotation finished."
            * Used parameter 'Annotation CutOff': The Blast2GO Annotation Rule seeks to find the most specific GO annotations with a certain level of reliability. An annotation score is calculated for each candidate GO which is composed by the sequence similarity of the Blast Hit, the evidence code of the source GO and the position of the particular GO in the Gene Ontology hierarchy. This annotation score cutoff select the most specific GO term for a given GO branch which lies above this value.
            * Used parameter 'GO Weight' is a value which is added to Annotation Score of a more general/abstract Gene Ontology term for each of its more specific, original source GO terms. In this case, more general GO terms which summarise many original source terms (those ones directly associated to the Blast Hits) will have a higher Annotation Score.
            "Annotation (CP020463_protein) Done"
            "Annotation finished."
    or blast2go_cli_v1.5.1 (NOT_USED)

            #https://help.biobam.com/space/BCD/2250407989/Installation
            #see ~/Scripts/blast2go_pipeline.sh

    Option 3 (GO Terms from 'Blast2GO 5 Basic', saved in blast2go_annot.annot2): Interpro based protein families / domains --> Button interpro
        * Button 'interpro' (Tags: INTERPRO, generated columns: InterPro IDs, InterPro GO IDs, InterPro GO Names) --> "InterProScan Finished - You can now merge the obtained GO Annotations."
            "InterProScan (CP020463_protein) Done"
            "InterProScan Finished - You can now merge the obtained GO Annotations."
    MERGE the results of InterPro GO IDs (Option 3) to GO IDs (Option 2) and generate final GO IDs
        * Button 'interpro'/'Merge InterProScan GOs to Annotation' --> "Merge (add and validate) all GO terms retrieved via InterProScan to the already existing GO annotation."
            "Merge InterProScan GOs to Annotation (CP020463_protein) Done"
            "Finished merging GO terms from InterPro with annotations."
            "Maybe you want to run ANNEX (Annotation Augmentation)."
        #* Button 'annot'/'ANNEX' --> "ANNEX finished. Maybe you want to do the next step: Enzyme Code Mapping."
    File -> Export -> Export Annotations -> Export Annotations (.annot, custom, etc.)
            #~/b2gWorkspace_Michelle_RNAseq_2025/blast2go_annot.annot is generated!

        #-- before merging (blast2go_annot.annot) --
        #H0N29_18790     GO:0004842      ankyrin repeat domain-containing protein
        #H0N29_18790     GO:0085020
        #-- after merging (blast2go_annot.annot2) -->
        #H0N29_18790     GO:0031436      ankyrin repeat domain-containing protein
        #H0N29_18790     GO:0070531
        #H0N29_18790     GO:0004842
        #H0N29_18790     GO:0005515
        #H0N29_18790     GO:0085020

        cp blast2go_annot.annot blast2go_annot.annot2

    Option 4 (NOT_USED): RFAM for non-colding RNA

    Option 5 (NOT_USED): PSORTb for subcellular localizations

    Option 6 (NOT_USED): KAAS (KEGG Automatic Annotation Server)

    * Go to KAAS
    * Upload your FASTA file.
    * Select an appropriate gene set.
    * Download the KO assignments.

10.2. Find the Closest KEGG Organism Code (NOT_USED)

    Since your species isn't directly in KEGG, use a closely related organism.

    * Check available KEGG organisms:

            library(clusterProfiler)
            library(KEGGREST)

            kegg_organisms <- keggList("organism")

            Pick the closest relative (e.g., zebrafish "dre" for fish, Arabidopsis "ath" for plants).

            # Search for Acinetobacter in the list
            grep("Acinetobacter", kegg_organisms, ignore.case = TRUE, value = TRUE)
            # Gammaproteobacteria
            #Extract KO IDs from the eggnog results for  "Acinetobacter baumannii strain ATCC 19606"

10.3. Find the Closest KEGG Organism for a Non-Model Species (NOT_USED)

    If your organism is not in KEGG, search for the closest relative:

            grep("fish", kegg_organisms, ignore.case = TRUE, value = TRUE)  # Example search

    For KEGG pathway enrichment in non-model species, use "ko" instead of a species code (the code has been intergrated in the point 4):

            kegg_enrich <- enrichKEGG(gene = gene_list, organism = "ko")  # "ko" = KEGG Orthology

10.4. Perform KEGG and GO Enrichment in R (under dir ~/DATA/Data_Tam_RNAseq_2025_LB_vs_Mac_ATCC19606/results/star_salmon/degenes)

        #BiocManager::install("GO.db")
        #BiocManager::install("AnnotationDbi")

        # Load required libraries
        library(openxlsx)  # For Excel file handling
        library(dplyr)     # For data manipulation
        library(tidyr)
        library(stringr)
        library(clusterProfiler)  # For KEGG and GO enrichment analysis
        #library(org.Hs.eg.db)  # Replace with appropriate organism database
        library(GO.db)
        library(AnnotationDbi)

        setwd("~/DATA/Data_Michelle_RNAseq_2025/results/star_salmon/degenes")
        # PREPARING go_terms and ec_terms: annot_* file: cut -f1-2 -d$'\t' blast2go_annot.annot2 > blast2go_annot.annot2_
        # PREPARING eggnog_out.emapper.annotations.txt from eggnog_out.emapper.annotations by removing ## lines and renaming #query to query
        #(plot-numpy1) jhuang@WS-2290C:~/DATA/Data_Tam_RNAseq_2024_AUM_MHB_Urine_ATCC19606$ diff eggnog_out.emapper.annotations eggnog_out.emapper.annotations.txt
        #1,5c1
        #< ## Thu Jan 30 16:34:52 2025
        #< ## emapper-2.1.12
        #< ## /home/jhuang/mambaforge/envs/eggnog_env/bin/emapper.py -i CP059040_protein.fasta -o eggnog_out --cpu 60
        #< ##
        #< #query        seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway    KEGG_Module     KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #---
        #> query seed_ortholog   evalue  score   eggNOG_OGs      max_annot_lvl   COG_category    Description     Preferred_name  GOs     EC      KEGG_ko KEGG_Pathway   KEGG_Module      KEGG_Reaction   KEGG_rclass     BRITE   KEGG_TC CAZy    BiGG_Reaction   PFAMs
        #3620,3622d3615
        #< ## 3614 queries scanned
        #< ## Total time (seconds): 8.176708459854126

        # Step 1: Load the blast2go annotation file with a check for missing columns
        annot_df <- read.table("/home/jhuang/b2gWorkspace_Michelle_RNAseq_2025/blast2go_annot.annot2_", header = FALSE, sep = "\t", stringsAsFactors = FALSE, fill = TRUE)

        # If the structure is inconsistent, we can make sure there are exactly 3 columns:
        colnames(annot_df) <- c("GeneID", "Term")
        # Step 2: Filter and aggregate GO and EC terms as before
        go_terms <- annot_df %>%
        filter(grepl("^GO:", Term)) %>%
        group_by(GeneID) %>%
        summarize(GOs = paste(Term, collapse = ","), .groups = "drop")
        ec_terms <- annot_df %>%
        filter(grepl("^EC:", Term)) %>%
        group_by(GeneID) %>%
        summarize(EC = paste(Term, collapse = ","), .groups = "drop")

        # Key Improvements:
        #    * Looped processing of all 6 input files to avoid redundancy.
        #    * Robust handling of empty KEGG and GO enrichment results to prevent contamination of results between iterations.
        #    * File-safe output: Each dataset creates a separate Excel workbook with enriched sheets only if data exists.
        #    * Error handling for GO term descriptions via tryCatch.
        #    * Improved clarity and modular structure for easier maintenance and future additions.

        # Define the filenames and output suffixes
        file_list <- c(
          "deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv",
          "deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv",
          "deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv",
          "deltasbp_MH_2h_vs_WT_MH_2h-all.csv",
          "deltasbp_MH_4h_vs_WT_MH_4h-all.csv",
          "deltasbp_MH_18h_vs_WT_MH_18h-all.csv",

          "WT_MH_4h_vs_WT_MH_2h",
          "WT_MH_18h_vs_WT_MH_2h",
          "WT_MH_18h_vs_WT_MH_4h",
          "WT_TSB_4h_vs_WT_TSB_2h",
          "WT_TSB_18h_vs_WT_TSB_2h",
          "WT_TSB_18h_vs_WT_TSB_4h",

          "deltasbp_MH_4h_vs_deltasbp_MH_2h",
          "deltasbp_MH_18h_vs_deltasbp_MH_2h",
          "deltasbp_MH_18h_vs_deltasbp_MH_4h",
          "deltasbp_TSB_4h_vs_deltasbp_TSB_2h",
          "deltasbp_TSB_18h_vs_deltasbp_TSB_2h",
          "deltasbp_TSB_18h_vs_deltasbp_TSB_4h"
        )

        #file_name = "deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv"

        # ---------------------- Generated DEG(Annotated)_KEGG_GO_* -----------------------
        suppressPackageStartupMessages({
          library(readr)
          library(dplyr)
          library(stringr)
          library(tidyr)
          library(openxlsx)
          library(clusterProfiler)
          library(AnnotationDbi)
          library(GO.db)
        })

        # ---- PARAMETERS ----
        PADJ_CUT <- 5e-2
        LFC_CUT  <- 2

        # Your emapper annotations (with columns: query, GOs, EC, KEGG_ko, KEGG_Pathway, KEGG_Module, ... )
        emapper_path <- "~/DATA/Data_Michelle_RNAseq_2025/eggnog_out.emapper.annotations.txt"

        # Input files (you can add/remove here)
        input_files <- c(
          "deltasbp_TSB_2h_vs_WT_TSB_2h-all.csv",
          "deltasbp_TSB_4h_vs_WT_TSB_4h-all.csv",
          "deltasbp_TSB_18h_vs_WT_TSB_18h-all.csv",
          "deltasbp_MH_2h_vs_WT_MH_2h-all.csv",
          "deltasbp_MH_4h_vs_WT_MH_4h-all.csv",
          "deltasbp_MH_18h_vs_WT_MH_18h-all.csv",

          "WT_MH_4h_vs_WT_MH_2h-all.csv",
          "WT_MH_18h_vs_WT_MH_2h-all.csv",
          "WT_MH_18h_vs_WT_MH_4h-all.csv",
          "WT_TSB_4h_vs_WT_TSB_2h-all.csv",
          "WT_TSB_18h_vs_WT_TSB_2h-all.csv",
          "WT_TSB_18h_vs_WT_TSB_4h-all.csv",

          "deltasbp_MH_4h_vs_deltasbp_MH_2h-all.csv",
          "deltasbp_MH_18h_vs_deltasbp_MH_2h-all.csv",
          "deltasbp_MH_18h_vs_deltasbp_MH_4h-all.csv",
          "deltasbp_TSB_4h_vs_deltasbp_TSB_2h-all.csv",
          "deltasbp_TSB_18h_vs_deltasbp_TSB_2h-all.csv",
          "deltasbp_TSB_18h_vs_deltasbp_TSB_4h-all.csv"
        )

        # ---- HELPERS ----
        # Robust reader (CSV first, then TSV)
        read_table_any <- function(path) {
          tb <- tryCatch(readr::read_csv(path, show_col_types = FALSE),
                        error = function(e) tryCatch(readr::read_tsv(path, col_types = cols()),
                                                      error = function(e2) NULL))
          tb
        }

        # Return a nice Excel-safe base name
        xlsx_name_from_file <- function(path) {
          base <- tools::file_path_sans_ext(basename(path))
          paste0("DEG_KEGG_GO_", base, ".xlsx")
        }

        # KEGG expand helper: replace K-numbers with GeneIDs using mapping from the same result table
        expand_kegg_geneIDs <- function(kegg_res, mapping_tbl) {
          if (is.null(kegg_res) || nrow(as.data.frame(kegg_res)) == 0) return(data.frame())
          kdf <- as.data.frame(kegg_res)
          if (!"geneID" %in% names(kdf)) return(kdf)
          # mapping_tbl: columns KEGG_ko (possibly multiple separated by commas) and GeneID
          map_clean <- mapping_tbl %>%
            dplyr::select(KEGG_ko, GeneID) %>%
            filter(!is.na(KEGG_ko), KEGG_ko != "-") %>%
            mutate(KEGG_ko = str_remove_all(KEGG_ko, "ko:")) %>%
            tidyr::separate_rows(KEGG_ko, sep = ",") %>%
            distinct()

          if (!nrow(map_clean)) {
            return(kdf)
          }

          expanded <- kdf %>%
            tidyr::separate_rows(geneID, sep = "/") %>%
            dplyr::left_join(map_clean, by = c("geneID" = "KEGG_ko"), relationship = "many-to-many") %>%
            distinct() %>%
            dplyr::group_by(ID) %>%
            dplyr::summarise(across(everything(), ~ paste(unique(na.omit(.)), collapse = "/")), .groups = "drop")

          kdf %>%
            dplyr::select(-geneID) %>%
            dplyr::left_join(expanded %>% dplyr::select(ID, GeneID), by = "ID") %>%
            dplyr::rename(geneID = GeneID)
        }

        # ---- LOAD emapper annotations ----
        eggnog_data <- read.delim(emapper_path, header = TRUE, sep = "\t", quote = "", check.names = FALSE)
        # Ensure character columns for joins
        eggnog_data$query   <- as.character(eggnog_data$query)
        eggnog_data$GOs     <- as.character(eggnog_data$GOs)
        eggnog_data$EC      <- as.character(eggnog_data$EC)
        eggnog_data$KEGG_ko <- as.character(eggnog_data$KEGG_ko)

        # ---- MAIN LOOP ----
        for (f in input_files) {
          if (!file.exists(f)) { message("Missing: ", f); next }

          message("Processing: ", f)
          res <- read_table_any(f)
          if (is.null(res) || nrow(res) == 0) { message("Empty/unreadable: ", f); next }

          # Coerce expected columns if present
          if ("padj" %in% names(res))   res$padj <- suppressWarnings(as.numeric(res$padj))
          if ("log2FoldChange" %in% names(res)) res$log2FoldChange <- suppressWarnings(as.numeric(res$log2FoldChange))

          # Ensure GeneID & GeneName exist
          if (!"GeneID" %in% names(res)) {
            # Try to infer from a generic 'gene' column
            if ("gene" %in% names(res)) res$GeneID <- as.character(res$gene) else res$GeneID <- NA_character_
          }
          if (!"GeneName" %in% names(res)) res$GeneName <- NA_character_

          # Fill missing GeneName from GeneID (drop "gene-")
          res$GeneName <- ifelse(is.na(res$GeneName) | res$GeneName == "",
                                gsub("^gene-", "", as.character(res$GeneID)),
                                as.character(res$GeneName))

          # De-duplicate by GeneName, keep smallest padj
          if (!"padj" %in% names(res)) res$padj <- NA_real_
          res <- res %>%
            group_by(GeneName) %>%
            slice_min(padj, with_ties = FALSE) %>%
            ungroup() %>%
            as.data.frame()

          # Sort by padj asc, then log2FC desc
          if (!"log2FoldChange" %in% names(res)) res$log2FoldChange <- NA_real_
          res <- res[order(res$padj, -res$log2FoldChange), , drop = FALSE]

          # Join emapper (strip "gene-" from GeneID to match emapper 'query')
          res$GeneID_plain <- gsub("^gene-", "", res$GeneID)
          res_ann <- res %>%
            left_join(eggnog_data, by = c("GeneID_plain" = "query"))

          # --- Split by UP/DOWN using your volcano cutoffs ---
          up_regulated   <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange >  LFC_CUT)
          down_regulated <- res_ann %>% filter(!is.na(padj), padj < PADJ_CUT,  log2FoldChange < -LFC_CUT)

          # --- KEGG enrichment (using K numbers in KEGG_ko) ---
          # Prepare KO lists (remove "ko:" if present)
          k_up <- up_regulated$KEGG_ko;   k_up <- k_up[!is.na(k_up)]
          k_dn <- down_regulated$KEGG_ko; k_dn <- k_dn[!is.na(k_dn)]
          k_up <- gsub("ko:", "", k_up);  k_dn <- gsub("ko:", "", k_dn)

          # BREAK_LINE

          kegg_up   <- tryCatch(enrichKEGG(gene = k_up, organism = "ko"), error = function(e) NULL)
          kegg_down <- tryCatch(enrichKEGG(gene = k_dn, organism = "ko"), error = function(e) NULL)

          # Convert KEGG K-numbers to your GeneIDs (using mapping from the same result set)
          kegg_up_df   <- expand_kegg_geneIDs(kegg_up,   up_regulated)
          kegg_down_df <- expand_kegg_geneIDs(kegg_down, down_regulated)

          # --- GO enrichment (custom TERM2GENE built from emapper GOs) ---
          # Background gene set = all genes in this comparison
          background_genes <- unique(res_ann$GeneID_plain)
          # TERM2GENE table (GO -> GeneID_plain)
          go_annotation <- res_ann %>%
            dplyr::select(GeneID_plain, GOs) %>%
            mutate(GOs = ifelse(is.na(GOs), "", GOs)) %>%
            tidyr::separate_rows(GOs, sep = ",") %>%
            filter(GOs != "") %>%
            dplyr::select(GOs, GeneID_plain) %>%
            distinct()

          # Gene lists for GO enricher
          go_list_up   <- unique(up_regulated$GeneID_plain)
          go_list_down <- unique(down_regulated$GeneID_plain)

          go_up <- tryCatch(
            enricher(gene = go_list_up, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )
          go_down <- tryCatch(
            enricher(gene = go_list_down, TERM2GENE = go_annotation,
                    pvalueCutoff = 0.05, pAdjustMethod = "BH",
                    universe = background_genes),
            error = function(e) NULL
          )

          go_up_df   <- if (!is.null(go_up))   as.data.frame(go_up)   else data.frame()
          go_down_df <- if (!is.null(go_down)) as.data.frame(go_down) else data.frame()

          # Add GO term descriptions via GO.db (best-effort)
          add_go_term_desc <- function(df) {
            if (!nrow(df) || !"ID" %in% names(df)) return(df)
            df$Description <- sapply(df$ID, function(go_id) {
              term <- tryCatch(AnnotationDbi::select(GO.db, keys = go_id,
                                                    columns = "TERM", keytype = "GOID"),
                              error = function(e) NULL)
              if (!is.null(term) && nrow(term)) term$TERM[1] else NA_character_
            })
            df
          }
          go_up_df   <- add_go_term_desc(go_up_df)
          go_down_df <- add_go_term_desc(go_down_df)

          # ---- Write Excel workbook ----
          out_xlsx <- xlsx_name_from_file(f)
          wb <- createWorkbook()

          addWorksheet(wb, "Complete")
          writeData(wb, "Complete", res_ann)

          addWorksheet(wb, "Up_Regulated")
          writeData(wb, "Up_Regulated", up_regulated)

          addWorksheet(wb, "Down_Regulated")
          writeData(wb, "Down_Regulated", down_regulated)

          addWorksheet(wb, "KEGG_Enrichment_Up")
          writeData(wb, "KEGG_Enrichment_Up", kegg_up_df)

          addWorksheet(wb, "KEGG_Enrichment_Down")
          writeData(wb, "KEGG_Enrichment_Down", kegg_down_df)

          addWorksheet(wb, "GO_Enrichment_Up")
          writeData(wb, "GO_Enrichment_Up", go_up_df)

          addWorksheet(wb, "GO_Enrichment_Down")
          writeData(wb, "GO_Enrichment_Down", go_down_df)

          saveWorkbook(wb, out_xlsx, overwrite = TRUE)
          message("Saved: ", out_xlsx)
        }
  1. Clustering the genes and draw heatmap

    #http://xgenes.com/article/article-content/150/draw-venn-diagrams-using-matplotlib/
    #http://xgenes.com/article/article-content/276/go-terms-for-s-epidermidis/
    # save the Up-regulated and Down-regulated genes into -up.id and -down.id
    
    for i in deltasbp_TSB_2h_vs_WT_TSB_2h deltasbp_TSB_4h_vs_WT_TSB_4h deltasbp_TSB_18h_vs_WT_TSB_18h deltasbp_MH_2h_vs_WT_MH_2h deltasbp_MH_4h_vs_WT_MH_4h deltasbp_MH_18h_vs_WT_MH_18h    WT_MH_4h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_4h WT_TSB_4h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_4h  deltasbp_MH_4h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_4h deltasbp_TSB_4h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_4h; do
      echo "cut -d',' -f1-1 ${i}-up.txt > ${i}-up.id";
      echo "cut -d',' -f1-1 ${i}-down.txt > ${i}-down.id";
    done
    
    #The row’s description column says “TsaE,” but the preferred_name is ydiB (shikimate/quinate dehydrogenase).
    #Length = 301 aa — that fits YdiB much better. TsaE (YjeE) is a small P-loop ATPase, typically ~150–170 aa, not ~300 aa.
    #The COG/orthology hit and the very strong e-value also point to a canonical enzyme rather than the tiny TsaE ATPase.
    #What likely happened
    #The “GeneName” (tsaE) was inherited from a prior/automated annotation.
    #Orthology mapping (preferred_name) recognizes the protein as YdiB; the free-text product line didn’t update, leaving a label clash.
    #What to do
    #Treat this locus as ydiB (shikimate dehydrogenase; aka AroE-II), not TsaE.
    #If you want to be thorough, BLAST the sequence and/or run InterPro/eggNOG: you should see SDR/oxidoreductase motifs for YdiB, not the P-loop NTPase (Walker A) you’d expect for TsaE.
    #Check your genome for the true t6A genes (tsaB/tsaD/tsaE/tsaC); the real tsaE should be a much smaller ORF.
    # -- Replace GeneName with Preferred_name when Preferred_name is non-empty and not '-' (first sheet). --
    # -- IMPORTANT_ADAPTION: the script by chaning "H0N29_" with "B4U56_"
    for i in deltasbp_TSB_2h_vs_WT_TSB_2h deltasbp_TSB_4h_vs_WT_TSB_4h deltasbp_TSB_18h_vs_WT_TSB_18h deltasbp_MH_2h_vs_WT_MH_2h deltasbp_MH_4h_vs_WT_MH_4h deltasbp_MH_18h_vs_WT_MH_18h    WT_MH_4h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_2h WT_MH_18h_vs_WT_MH_4h WT_TSB_4h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_2h WT_TSB_18h_vs_WT_TSB_4h  deltasbp_MH_4h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_2h deltasbp_MH_18h_vs_deltasbp_MH_4h deltasbp_TSB_4h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_2h deltasbp_TSB_18h_vs_deltasbp_TSB_4h; do
      python ~/Scripts/replace_with_preferred_name.py DEG_KEGG_GO_${i}-all.xlsx -o ${i}-all_annotated.csv
    done
    
    #for f in *-all_annotated.csv; do sed -i '1s/^GeneName,/GeneName2,/;1s/,Description,/,GeneName,/' "$f"; done
    
    for f in *-all_annotated.csv; do
      awk -v FPAT='([^,]*)|("[^"]*")' -v OFS=',' '
        NR==1{
          for(i=1;i<=NF;i++){ if($i=="GeneName") g=i; if($i=="Description") d=i }
          print; next
        }
        { $g=$g" ("$d")"; print }' "$f" > tmp && mv tmp "$f"
    done
    
    # ------------------ Heatmap generation for two samples ----------------------
    
    ## ------------------------------------------------------------
    ## DEGs heatmap (dynamic GOI + dynamic column tags)
    ## Example contrast: deltasbp_TSB_2h_vs_WT_TSB_2h
    ## Assumes 'rld' (or 'vsd') is in the environment (DESeq2 transform)
    ## ------------------------------------------------------------
    
    #RUN rld generation code (see the first part of the file)
    setwd("degenes")
    ## 0) Config ---------------------------------------------------
    contrast <- "deltasbp_TSB_2h_vs_WT_TSB_2h"    #17, height=600, heatmap_pattern1
    contrast <- "deltasbp_TSB_4h_vs_WT_TSB_4h"    #25, height=800, heatmap_pattern1
    contrast <- "deltasbp_TSB_18h_vs_WT_TSB_18h"  #34, height=1000, heatmap_pattern1
    contrast <- "deltasbp_MH_2h_vs_WT_MH_2h"      #43, height=1200, heatmap_pattern1
    contrast <- "deltasbp_MH_4h_vs_WT_MH_4h"      #26, height=800, heatmap_pattern1
    contrast <- "deltasbp_MH_18h_vs_WT_MH_18h"    #41, height=1200, heatmap_pattern1
    
    ## 1) Packages -------------------------------------------------
    need <- c("gplots")
    to_install <- setdiff(need, rownames(installed.packages()))
    if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org")
    suppressPackageStartupMessages(library(gplots))
    
    ## 2) Helpers --------------------------------------------------
    # Read IDs from a file that may be:
    #  - one column with or without header "Gene_Id"
    #  - may contain quotes
    read_ids_from_file <- function(path) {
      #path <- up_file
      if (!file.exists(path)) stop("File not found: ", path)
      df <- tryCatch(
        read.table(path, header = TRUE, stringsAsFactors = FALSE, quote = "\"'", comment.char = ""),
        error = function(e) NULL
      )
      if (!is.null(df) && ncol(df) >= 1) {
        if ("Gene_Id" %in% names(df)) {
          ids <- df[["Gene_Id"]]
        } else if (ncol(df) == 1L) {
          ids <- df[[1]]
        } else {
          first_nonempty <- which(colSums(df != "", na.rm = TRUE) > 0)[1]
          if (is.na(first_nonempty)) stop("No usable IDs in: ", path)
          ids <- df[[first_nonempty]]
        }
      } else {
        df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "")
        if (ncol(df2) < 1L) stop("No usable IDs in: ", path)
        ids <- df2[[1]]
      }
      ids <- trimws(gsub('"', "", ids))
      ids[nzchar(ids)]
    }
    
    #BREAK_LINE
    
    # From "A_vs_B" get c("A","B")
    split_contrast_groups <- function(x) {
      parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]]
      if (length(parts) != 2L) stop("Contrast must be in the form 'GroupA_vs_GroupB'")
      parts
    }
    
    # Match whole tags at boundaries or underscores
    match_tags <- function(nms, tags) {
      pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)")
      grepl(pat, nms, perl = TRUE)
    }
    
    ## 3) Expression matrix (DESeq2 rlog/vst) ----------------------
    # Use rld if present; otherwise try vsd
    if (exists("rld")) {
      expr_all <- assay(rld)
    } else if (exists("vsd")) {
      expr_all <- assay(vsd)
    } else {
      stop("Neither 'rld' nor 'vsd' object is available in the environment.")
    }
    RNASeq.NoCellLine <- as.matrix(expr_all)
    #NOT_NECCESSARY since it was already sorted: colnames(RNASeq.NoCellLine) <- c("WT_none_17_r1", "WT_none_17_r2", "WT_none_17_r3", "WT_none_24_r1", "WT_none_24_r2", "WT_none_24_r3", "deltaadeIJ_none_17_r1", "deltaadeIJ_none_17_r2", "deltaadeIJ_none_17_r3", "deltaadeIJ_none_24_r1", "deltaadeIJ_none_24_r2", "deltaadeIJ_none_24_r3", "WT_one_17_r1", "WT_one_17_r2", "WT_one_17_r3", "WT_one_24_r1", "WT_one_24_r2", "WT_one_24_r3", "deltaadeIJ_one_17_r1", "deltaadeIJ_one_17_r2", "deltaadeIJ_one_17_r3", "deltaadeIJ_one_24_r1", "deltaadeIJ_one_24_r2", "deltaadeIJ_one_24_r3", "WT_two_17_r1",      "WT_two_17_r2", "WT_two_17_r3", "WT_two_24_r1", "WT_two_24_r2", "WT_two_24_r3", "deltaadeIJ_two_17_r1", "deltaadeIJ_two_17_r2", "deltaadeIJ_two_17_r3", "deltaadeIJ_two_24_r1", "deltaadeIJ_two_24_r2", "deltaadeIJ_two_24_r3")
    
    # -- RUN the code with the new contract from HERE after first run --
    
    ## 4) Build GOI from the two .id files (Note that if empty not run!)-------------------------
    up_file   <- paste0(contrast, "-up.id")
    down_file <- paste0(contrast, "-down.id")
    GOI_up   <- read_ids_from_file(up_file)
    GOI_down <- read_ids_from_file(down_file)
    GOI <- unique(c(GOI_up, GOI_down))
    if (length(GOI) == 0) stop("No gene IDs found in up/down .id files.")
    
    # GOI are already 'gene-*' in your data — use them directly for matching
    present <- intersect(rownames(RNASeq.NoCellLine), GOI)
    if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.")
    # Optional: report truly missing IDs (on the same 'gene-*' format)
    missing <- setdiff(GOI, present)
    if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.")
    
    ## 5) Keep ONLY columns for the two groups in the contrast -----
    groups <- split_contrast_groups(contrast)  # e.g., c("deltasbp_TSB_2h", "WT_TSB_2h")
    keep_cols <- match_tags(colnames(RNASeq.NoCellLine), groups)
    if (!any(keep_cols)) {
      stop("No columns matched the contrast groups: ", paste(groups, collapse = " and "),
          ". Check your column names or implement colData-based filtering.")
    }
    cols_idx <- which(keep_cols)
    sub_colnames <- colnames(RNASeq.NoCellLine)[cols_idx]
    
    # Put the second group first (e.g., WT first in 'deltasbp..._vs_WT...')
    ord <- order(!grepl(paste0("(^|_)", groups[2], "(_|$)"), sub_colnames, perl = TRUE))
    
    # Subset safely
    expr_sub <- RNASeq.NoCellLine[present, cols_idx, drop = FALSE][, ord, drop = FALSE]
    
    ## 6) Remove constant/NA rows ----------------------------------
    row_ok <- apply(expr_sub, 1, function(x) is.finite(sum(x)) && var(x, na.rm = TRUE) > 0)
    if (any(!row_ok)) message("Removing ", sum(!row_ok), " constant/NA rows.")
    datamat <- expr_sub[row_ok, , drop = FALSE]
    
    # Save the filtered matrix used for the heatmap (optional)
    out_mat <- paste0("DEGs_heatmap_expression_data_", contrast, ".txt")
    write.csv(as.data.frame(datamat), file = out_mat, quote = FALSE)
    
    #BREAK_LINE
    
    ## 7) Pretty labels (display only) ---------------------------
    # Start from rownames(datamat) (assumed to be GeneID)
    labRow_pretty <- rownames(datamat)
    # ---- Replace GeneID with GeneName from "
    -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty ‘ΔadeIJ’ and nicer spacing labCol_pretty <- colnames(datamat) labCol_pretty <- gsub("^deltasbp", "\u0394sbp", labCol_pretty) labCol_pretty “WT TSB 2h r1” # If you prefer to drop replicate suffixes, uncomment: # labCol_pretty <- gsub(" r\\d+$", "", labCol_pretty) ## 8) Clustering ———————————————– # Row clustering with Pearson distance hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") #row_cor <- suppressWarnings(cor(t(datamat), method = "pearson", use = "pairwise.complete.obs")) #row_cor[!is.finite(row_cor)] <- 0 #hr <- hclust(as.dist(1 – row_cor), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.1) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] #BREAK_LINE # DEBUG for some items starting with "gene-" labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty <- sub("^rna-", "", labRow_pretty) labRow_pretty <- gsub('"', "", labRow_pretty) #labRow_pretty <- gsub('\\"', "", labRow_pretty) # truncate if longer than threshold (e.g. 30 characters) threshold <- 152 labRow_pretty threshold, paste0(substr(labRow_pretty, 1, threshold), “…”), labRow_pretty ) # heatmap_pattern1 png(paste0(“DEGs_heatmap_”, contrast, “.png”), width=1800, height=1200) heatmap.2(datamat, Rowv = as.dendrogram(hr), Colv = FALSE, # no column clustering dendrogram = “none”, #’row’, col = bluered(75), scale = “row”, #RowSideColors = mycol, trace = “none”, margin = c(10, 120), # bottom, left, old is 20 sepwidth = c(0, 0), density.info = ‘none’, labRow = labRow_pretty, # row labels WITHOUT “gene-” labCol = labCol_pretty, # col labels with Δsbp + spaces cexRow = 2.0, cexCol = 2.0, srtCol = 40, lhei = c(0.6, 4), # enlarge the first number when reduce the plot size to avoid the error ‘Error in plot.new() : figure margins too large’ lwid = c(0.2, 4)) # enlarge the first number when reduce the plot size to avoid the error ‘Error in plot.new() : figure margins too large’ dev.off() # heatmap_pattern2 png(paste0(“DEGs_heatmap_”, contrast, “.png”), width = 1800, height = 6500) heatmap.2( datamat, Rowv = as.dendrogram(hr), Colv = FALSE, dendrogram = “row”, col = bluered(75), scale = “row”, trace = “none”, density.info = “none”, RowSideColors = mycol, margins = c(10, 15), # c(bottom, left) sepwidth = c(0, 0), labRow = labRow_pretty, labCol = labCol_pretty, cexRow = 1.4, # ↓ smaller column label font (was 1.3) cexCol = 1.8, srtCol = 20, lhei = c(0.01, 4), lwid = c(0.5, 4), key = FALSE # safer; add manual z-score key if you want (see note below) ) dev.off() # —————— Heatmap generation for three samples ———————- ## ============================================================ ## Three-condition DEGs heatmap from multiple pairwise contrasts ## Example contrasts: ## “WT_MH_4h_vs_WT_MH_2h”, ## “WT_MH_18h_vs_WT_MH_2h”, ## “WT_MH_18h_vs_WT_MH_4h” ## Output shows the union of DEGs across all contrasts and ## only the columns (samples) for the 3 conditions. ## ============================================================ ## ——– 0) User inputs ———————————— contrasts 424 genes, height=6000, heatmap_pattern2 ) contrasts 358 genes, height=5200, heatmap_pattern2 ) contrasts 345 genes, height=5120, heatmap_pattern2 ) contrasts 276 genes, height=4000, heatmap_pattern2 ) ## Optionally force a condition display order (defaults to order of first appearance) cond_order <- c("WT_MH_2h","WT_MH_4h","WT_MH_18h") cond_order <- c("WT_TSB_2h","WT_TSB_4h","WT_TSB_18h") cond_order <- c("deltasbp_MH_2h","deltasbp_MH_4h","deltasbp_MH_18h") cond_order <- c("deltasbp_TSB_2h","deltasbp_TSB_4h","deltasbp_TSB_18h") #cond_order <- NULL ## ——– 1) Packages ————————————— need <- c("gplots") to_install <- setdiff(need, rownames(installed.packages())) if (length(to_install)) install.packages(to_install, repos = "https://cloud.r-project.org") suppressPackageStartupMessages(library(gplots)) ## ——– 2) Helpers —————————————- read_ids_from_file <- function(path) { if (!file.exists(path)) stop("File not found: ", path) df = 1) { ids <- if ("Gene_Id" %in% names(df)) df[["Gene_Id"]] else df[[1]] } else { df2 <- read.table(path, header = FALSE, stringsAsFactors = FALSE, quote = "\"'", comment.char = "") ids <- df2[[1]] } ids <- trimws(gsub('"', "", ids)) ids[nzchar(ids)] } # From "A_vs_B" return c("A","B") split_contrast_groups <- function(x) { parts <- strsplit(x, "_vs_", fixed = TRUE)[[1]] if (length(parts) != 2L) stop("Contrast must be 'GroupA_vs_GroupB': ", x) parts } # Grep whole tag between start/end or underscores match_tags <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # Pretty labels for columns (optional tweaks) prettify_col_labels <- function(x) { x <- gsub("^deltasbp", "\u0394sbp", x) # example from your earlier case x <- gsub("_", " ", x) x } # BREAK_LINE # — RUN the code with the new contract from HERE after first run — ## ——– 3) Build GOI (union across contrasts) ————- up_files <- paste0(contrasts, "-up.id") down_files <- paste0(contrasts, "-down.id") GOI <- unique(unlist(c( lapply(up_files, read_ids_from_file), lapply(down_files, read_ids_from_file) ))) if (!length(GOI)) stop("No gene IDs found in any up/down .id files for the given contrasts.") ## ——– 4) Expression matrix (rld or vsd) —————– if (exists("rld")) { expr_all <- assay(rld) } else if (exists("vsd")) { expr_all <- assay(vsd) } else { stop("Neither 'rld' nor 'vsd' object is available in the environment.") } expr_all <- as.matrix(expr_all) present <- intersect(rownames(expr_all), GOI) if (!length(present)) stop("None of the GOI were found among the rownames of the expression matrix.") missing <- setdiff(GOI, present) if (length(missing)) message("Note: ", length(missing), " GOI not found and will be skipped.") ## ——– 5) Infer the THREE condition tags —————– pair_groups <- lapply(contrasts, split_contrast_groups) # list of c(A,B) cond_tags <- unique(unlist(pair_groups)) if (length(cond_tags) != 3L) { stop("Expected exactly three unique condition tags across the contrasts, got: ", paste(cond_tags, collapse = ", ")) } # If user provided an explicit order, use it; else keep first-appearance order if (!is.null(cond_order)) { if (!setequal(cond_order, cond_tags)) stop("cond_order must contain exactly these tags: ", paste(cond_tags, collapse = ", ")) cond_tags <- cond_order } #BREAK_LINE ## ——– 6) Subset columns to those 3 conditions ———– # helper: does a name contain any of the tags? match_any_tag <- function(nms, tags) { pat <- paste0("(^|_)(?:", paste(tags, collapse = "|"), ")(_|$)") grepl(pat, nms, perl = TRUE) } # helper: return the specific tag that a single name matches detect_tag <- function(nm, tags) { hits <- vapply(tags, function(t) grepl(paste0("(^|_)", t, "(_|$)"), nm, perl = TRUE), logical(1)) if (!any(hits)) NA_character_ else tags[which(hits)[1]] } keep_cols <- match_any_tag(colnames(expr_all), cond_tags) if (!any(keep_cols)) { stop("No columns matched any of the three condition tags: ", paste(cond_tags, collapse = ", ")) } sub_idx <- which(keep_cols) sub_colnames <- colnames(expr_all)[sub_idx] # find the tag for each kept column (this is the part that was wrong before) cond_for_col <- vapply(sub_colnames, detect_tag, character(1), tags = cond_tags) # rank columns by your desired condition order, then by name within each condition cond_rank <- match(cond_for_col, cond_tags) ord <- order(cond_rank, sub_colnames) expr_sub <- expr_all[present, sub_idx, drop = FALSE][, ord, drop = FALSE] ## ——– 7) Remove constant/NA rows ———————— row_ok 0) if (any(!row_ok)) message(“Removing “, sum(!row_ok), ” constant/NA rows.”) datamat <- expr_sub[row_ok, , drop = FALSE] ## ——– 8) Labels —————————————- labRow_pretty <- rownames(datamat) # —- Replace GeneID with GeneName from " -all_annotated.csv” all_path <- paste0(contrast, "-all_annotated.csv") if (file.exists(all_path)) { ann <- read.csv(all_path, stringsAsFactors = FALSE, check.names = FALSE) pick_col <- function(df, candidates) { hit <- intersect(candidates, names(df)) if (length(hit) == 0) return(NA_character_) hit[1] } id_col <- pick_col(ann, c("GeneID","Gene.ID","Gene_Id","Gene","gene_id","LocusTag","locus_tag","ID")) nm_col <- pick_col(ann, c("GeneName","Gene.Name","Gene_Name","Symbol","gene_name","Name","SYMBOL")) if (!is.na(id_col) && !is.na(nm_col)) { ann[[nm_col]][is.na(ann[[nm_col]])] <- "" id2name <- setNames(ann[[nm_col]], ann[[id_col]]) id2name <- id2name[nzchar(id2name)] # drop empty names hits <- match(rownames(datamat), names(id2name)) repl <- ifelse(is.na(hits), rownames(datamat), id2name[hits]) # avoid duplicate labels on the plot labRow_pretty <- make.unique(repl, sep = "_") } else { warning("Could not find GeneID/GeneName columns in ", all_path) } } else { warning("File not found: ", all_path) } labCol_pretty <- prettify_col_labels(colnames(datamat)) #BREAK_LINE ## ——– 9) Clustering (rows) —————————— hr <- hclust(as.dist(1 – cor(t(datamat), method = "pearson")), method = "complete") # Color row-side groups by cutting the dendrogram mycl <- cutree(hr, h = max(hr$height) / 1.3) palette_base <- c("yellow","blue","orange","magenta","cyan","red","green","maroon", "lightblue","pink","purple","lightcyan","salmon","lightgreen") mycol <- palette_base[(as.vector(mycl) – 1) %% length(palette_base) + 1] ## ——– 10) Save the matrix used ————————– out_tag <- paste(cond_tags, collapse = "_") write.csv(as.data.frame(datamat), file = paste0("DEGs_heatmap_expression_data_", out_tag, ".txt"), quote = FALSE) ## ——– 11) Plot heatmap ———————————- labRow_pretty <- sub("^gene-", "", labRow_pretty) labRow_pretty <- sub("^rna-", "", labRow_pretty) labRow_pretty <- gsub('"', "", labRow_pretty) threshold <- 240 labRow_pretty threshold, paste0(substr(labRow_pretty, 1, threshold), “…”), labRow_pretty ) png(paste0(“DEGs_heatmap_”, out_tag, “.png”), width = 1800, height = 4000) heatmap.2( datamat, Rowv = as.dendrogram(hr), Colv = FALSE, dendrogram = “none”, #’row’, col = bluered(75), scale = “row”, trace = “none”, density.info = “none”, #RowSideColors = mycol, margins = c(10, 120), # c(bottom, left), 15–>120 sepwidth = c(0, 0), labRow = labRow_pretty, labCol = labCol_pretty, cexRow = 1.3, cexCol = 1.5, srtCol = 60, lhei = c(0.01, 4), lwid = c(0.1, 4), key = FALSE # safer; add manual z-score key if you want (see note below) ) dev.off() # —————— Heatmap generation for three samples END ———————- # — (OLD ORIGINAL CODE for heatmap containing all samples) DEGs_heatmap_deltasbp_TSB_2h_vs_WT_TSB_2h — cat deltasbp_TSB_2h_vs_WT_TSB_2h-up.id deltasbp_TSB_2h_vs_WT_TSB_2h-down.id | sort -u > ids #add Gene_Id in the first line, delete the “” #Note that using GeneID as index, rather than GeneName, since .txt contains only GeneID. GOI <- read.csv("ids")$Gene_Id RNASeq.NoCellLine <- assay(rld) #install.packages("gplots") library("gplots") #clustering methods: "ward.D", "ward.D2", "single", "complete", "average" (= UPGMA), "mcquitty" (= WPGMA), "median" (= WPGMC) or "centroid" (= UPGMC). pearson or spearman datamat = RNASeq.NoCellLine[GOI, ] #datamat = RNASeq.NoCellLine write.csv(as.data.frame(datamat), file ="DEGs_heatmap_expression_data.txt") constant_rows <- apply(datamat, 1, function(row) var(row) == 0) if(any(constant_rows)) { cat("Removing", sum(constant_rows), "constant rows.\n") datamat <- datamat[!constant_rows, ] } hr <- hclust(as.dist(1-cor(t(datamat), method="pearson")), method="complete") hc <- hclust(as.dist(1-cor(datamat, method="spearman")), method="complete") mycl = cutree(hr, h=max(hr$height)/1.1) mycol = c("YELLOW", "BLUE", "ORANGE", "MAGENTA", "CYAN", "RED", "GREEN", "MAROON", "LIGHTBLUE", "PINK", "MAGENTA", "LIGHTCYAN", "LIGHTRED", "LIGHTGREEN"); mycol = mycol[as.vector(mycl)] png("DEGs_heatmap_deltasbp_TSB_2h_vs_WT_TSB_2h.png", width=1200, height=2000) heatmap.2(datamat, Rowv = as.dendrogram(hr), col = bluered(75), scale = "row", RowSideColors = mycol, trace = "none", margin = c(10, 15), # bottom, left sepwidth = c(0, 0), dendrogram = 'row', Colv = 'false', density.info = 'none', labRow = rownames(datamat), cexRow = 1.5, cexCol = 1.5, srtCol = 35, lhei = c(0.2, 4), # reduce top space (was 1 or more) lwid = c(0.4, 4)) # reduce left space (was 1 or more) dev.off() # ————– Cluster members —————- write.csv(names(subset(mycl, mycl == '1')),file='cluster1_YELLOW.txt') write.csv(names(subset(mycl, mycl == '2')),file='cluster2_DARKBLUE.txt') write.csv(names(subset(mycl, mycl == '3')),file='cluster3_DARKORANGE.txt') write.csv(names(subset(mycl, mycl == '4')),file='cluster4_DARKMAGENTA.txt') write.csv(names(subset(mycl, mycl == '5')),file='cluster5_DARKCYAN.txt') #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.txt -d',' -o DEGs_heatmap_cluster_members.xls #~/Tools/csv2xls-0.4/csv_to_xls.py DEGs_heatmap_expression_data.txt -d',' -o DEGs_heatmap_expression_data.xls; #### (NOT_WORKING) cluster members (adding annotations, note that it does not work for the bacteria, since it is not model-speices and we cannot use mart=ensembl) ##### subset_1<-names(subset(mycl, mycl == '1')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_1, ]) #2575 subset_2<-names(subset(mycl, mycl == '2')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_2, ]) #1855 subset_3<-names(subset(mycl, mycl == '3')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_3, ]) #217 subset_4<-names(subset(mycl, mycl == '4')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_4, ]) # subset_5<-names(subset(mycl, mycl == '5')) data <- as.data.frame(datamat[rownames(datamat) %in% subset_5, ]) # # Initialize an empty data frame for the annotated data annotated_data <- data.frame() # Determine total number of genes total_genes <- length(rownames(data)) # Loop through each gene to annotate for (i in 1:total_genes) { gene <- rownames(data)[i] result 1) { result <- result[1, ] } # Check if the result is empty if (nrow(result) == 0) { result <- data.frame(ensembl_gene_id = gene, external_gene_name = NA, gene_biotype = NA, entrezgene_id = NA, chromosome_name = NA, start_position = NA, end_position = NA, strand = NA, description = NA) } # Transpose expression values expression_values <- t(data.frame(t(data[gene, ]))) colnames(expression_values) <- colnames(data) # Combine gene information and expression data combined_result <- cbind(result, expression_values) # Append to the final dataframe annotated_data <- rbind(annotated_data, combined_result) # Print progress every 100 genes if (i %% 100 == 0) { cat(sprintf("Processed gene %d out of %d\n", i, total_genes)) } } # Save the annotated data to a new CSV file write.csv(annotated_data, "cluster1_YELLOW.csv", row.names=FALSE) write.csv(annotated_data, "cluster2_DARKBLUE.csv", row.names=FALSE) write.csv(annotated_data, "cluster3_DARKORANGE.csv", row.names=FALSE) write.csv(annotated_data, "cluster4_DARKMAGENTA.csv", row.names=FALSE) write.csv(annotated_data, "cluster5_DARKCYAN.csv", row.names=FALSE) #~/Tools/csv2xls-0.4/csv_to_xls.py cluster*.csv -d',' -o DEGs_heatmap_clusters.xls