Author: gene_x

Abstract: 1. adapter sequence Lexogen small RNA-Seq kit some common adapter sequences from different kits for reference: - TruSeq Small RNA (Illumina): TGGAATTCTCGGGTGCCAAGG - Small RNA Kits V1 (Il

Author: gene_x

Abstract: If two haplotypes in a diploid organism are different, then the genome sequences for those haplotypes are also different. These genetic differences can indeed impact gene expression, and there are var

Author: gene_x

Abstract: * ./1_generate_promoter_sequences.py gencode.v43.annotation.gtf.db [1_generate_promoter_sequences.py](/static/peaks_and_motifs_in_promoters/1_generate_promoter_sequences.py "1_generate_promoter_sequ

Author: gene_x

Abstract: [](/static/peaks_and_motifs_in_promoters/Density_of_GRGGC_Motifs.png "Density_of_

Author: gene_x

Abstract: Small RNA sequencing is a type of RNA-sequencing (RNA-seq) that specifically targets and sequences small RNA molecules in a sample. RNA-seq is a technique that uses next-generation sequencing (NGS) t

Author: gene_x

Abstract: 1. nextflow ChIP-seq run for NHDF_p783 #under Raw_Data for ChIP-seq ln -s ./230306_NB501882_0417_AHMVHHBGXN/2023_022_nf_denise/nf859/3_NHDF_Donor_1_p783_input_S5_R1_001.fastq.gz p783

Author: gene_x

Abstract: 1. I used an strategy, at first annotate the contigs using the virus-speicific data and bacteria-speicific data, then using more general databases nt and nr. The results are as attached. For some samp

Author: gene_x

Abstract: Using spaceranger to process spatial transcriptomics data involves several steps, from preparing the necessary input files to running the analysis and interpreting the results. Below, I'll provide a c

Author: gene_x

Abstract: 1. Restricting User 'malawi' from Installing System-wide Programs and Verifying Permissions chmod o-rx /home/jhuang ls -ld /home/jhuang cd /home/jhuang groups malawi

Author: gene_x

Abstract: 1. nextflow processing data (chipseq) jhuang@hamm:/mnt/h1/jhuang/DATA/Data_Denise_LT_DNA_Binding/Histone-ChIP_hg38/H3K27ac_H3K4me1_public$ nextflow run NGI-ChIPseq/main.nf --reads '/mnt/h1/jh